EMAIL THIS PAGE TO A FRIEND

KIAA0825

KIAA0825

22 Gene Product Result for
Synonyms: C5orf36
UniProtKB ID: Q8IV33, O94914, Q6ZNN2
Gene ID:
chicken(427110) KIAA0825
cow(617013) KIAA0825 ortholog
domestic cat(101080612) KIAA0825 ortholog
dog(609433) KIAA0825 ortholog
domestic guinea pig(100720932) KIAA0825 ortholog
naked mole-rat(101726714) KIAA0825 ortholog
sheep(101107863) KIAA0825 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173665 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173665 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173665 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU138471 MISSION® esiRNA esiRNA human C5orf36 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173665 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173665 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138714 predicted 967
2 SASI_Hs01_00138715 predicted 928
3 SASI_Hs01_00138716 predicted 436
4 SASI_Hs01_00138717 predicted 939
5 SASI_Hs01_00138718 predicted 811
6 SASI_Hs01_00138719 predicted 445
7 SASI_Hs01_00138720 predicted 915
8 SASI_Hs01_00138721 predicted 869
9 SASI_Hs01_00138722 predicted 315
10 SASI_Hs01_00138723 predicted 924
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173665
KIAA0825 MISSION shRNA Bacterial Glycerol Stock
KIAA0825
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121531    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173665.1-1652s1c1
Sequence:CCGGCATTGTATCTTCCAAAGCTAACTCGAGTTAGCTTTGGAAGATACAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173665.1-813s1c1
Sequence:CCGGGTGCTTACAACAACTCTTGTTCTCGAGAACAAGAGTTGTTGTAAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173665.1-903s1c1
Sequence:CCGGGTGGAACTGCTTTCCTTCTTACTCGAGTAAGAAGGAAAGCAGTTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173665.1-427s1c1
Sequence:CCGGCAAACAACAACTGACTGCTTTCTCGAGAAAGCAGTCAGTTGTTGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173665.1-623s1c1
Sequence:CCGGCAACCCTAAGTGGAACATCTTCTCGAGAAGATGTTCCACTTAGGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173665.1-888s1c1
Sequence:CCGGGTTGGCTAATCTTCTGTGGAACTCGAGTTCCACAGAAGATTAGCCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173665.1-700s1c1
Sequence:CCGGGTCAAGTCTATGTGGGATGATCTCGAGATCATCCCACATAGACTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173665.1-492s1c1
Sequence:CCGGCATTTCTCATGGAGACTTGATCTCGAGATCAAGTCTCCATGAGAAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144532    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173665.1-1651s1c1
Sequence:CCGGCCATTGTATCTTCCAAAGCTACTCGAGTAGCTTTGGAAGATACAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173665.1-748s1c1
Sequence:CCGGGTGAGCAAATTACAAAGCCATCTCGAGATGGCTTTGTAATTTGCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173665.1-1060s1c1
Sequence:CCGGGAAACTTACCTGGATACTGTTCTCGAGAACAGTATCCAGGTAAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173665
KIAA0825 MISSION shRNA shRNA Plasmid DNA
KIAA0825
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121531    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173665.1-1652s1c1
Sequence:CCGGCATTGTATCTTCCAAAGCTAACTCGAGTTAGCTTTGGAAGATACAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173665.1-813s1c1
Sequence:CCGGGTGCTTACAACAACTCTTGTTCTCGAGAACAAGAGTTGTTGTAAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173665.1-903s1c1
Sequence:CCGGGTGGAACTGCTTTCCTTCTTACTCGAGTAAGAAGGAAAGCAGTTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173665.1-427s1c1
Sequence:CCGGCAAACAACAACTGACTGCTTTCTCGAGAAAGCAGTCAGTTGTTGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173665.1-623s1c1
Sequence:CCGGCAACCCTAAGTGGAACATCTTCTCGAGAAGATGTTCCACTTAGGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173665.1-888s1c1
Sequence:CCGGGTTGGCTAATCTTCTGTGGAACTCGAGTTCCACAGAAGATTAGCCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173665.1-700s1c1
Sequence:CCGGGTCAAGTCTATGTGGGATGATCTCGAGATCATCCCACATAGACTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173665.1-492s1c1
Sequence:CCGGCATTTCTCATGGAGACTTGATCTCGAGATCAAGTCTCCATGAGAAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144532    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173665.1-1651s1c1
Sequence:CCGGCCATTGTATCTTCCAAAGCTACTCGAGTAGCTTTGGAAGATACAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173665.1-748s1c1
Sequence:CCGGGTGAGCAAATTACAAAGCCATCTCGAGATGGCTTTGTAATTTGCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173665.1-1060s1c1
Sequence:CCGGGAAACTTACCTGGATACTGTTCTCGAGAACAGTATCCAGGTAAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173665
KIAA0825 MISSION shRNA Lentiviral Transduction Particles
KIAA0825
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121531    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173665.1-1652s1c1
Sequence:CCGGCATTGTATCTTCCAAAGCTAACTCGAGTTAGCTTTGGAAGATACAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173665.1-813s1c1
Sequence:CCGGGTGCTTACAACAACTCTTGTTCTCGAGAACAAGAGTTGTTGTAAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173665.1-903s1c1
Sequence:CCGGGTGGAACTGCTTTCCTTCTTACTCGAGTAAGAAGGAAAGCAGTTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173665.1-427s1c1
Sequence:CCGGCAAACAACAACTGACTGCTTTCTCGAGAAAGCAGTCAGTTGTTGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173665.1-623s1c1
Sequence:CCGGCAACCCTAAGTGGAACATCTTCTCGAGAAGATGTTCCACTTAGGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173665.1-888s1c1
Sequence:CCGGGTTGGCTAATCTTCTGTGGAACTCGAGTTCCACAGAAGATTAGCCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173665.1-700s1c1
Sequence:CCGGGTCAAGTCTATGTGGGATGATCTCGAGATCATCCCACATAGACTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173665.1-492s1c1
Sequence:CCGGCATTTCTCATGGAGACTTGATCTCGAGATCAAGTCTCCATGAGAAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144532    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173665.1-1651s1c1
Sequence:CCGGCCATTGTATCTTCCAAAGCTACTCGAGTAGCTTTGGAAGATACAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173665.1-748s1c1
Sequence:CCGGGTGAGCAAATTACAAAGCCATCTCGAGATGGCTTTGTAATTTGCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173665.1-1060s1c1
Sequence:CCGGGAAACTTACCTGGATACTGTTCTCGAGAACAGTATCCAGGTAAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)