EMAIL THIS PAGE TO A FRIEND

KIAA0895

KIAA0895

128 Gene Product Result for
Gene ID:
chicken(420739) KIAA0895
cow(527805) KIAA0895 ortholog
domestic cat(101100955) KIAA0895 ortholog
dog(482400) KIAA0895 ortholog
sheep(101116307) KIAA0895 ortholog
domestic guinea pig(100714950) KIAA0895 ortholog
naked mole-rat(101721194) KIAA0895 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_374425 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_374425 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_374425 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015314 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015314 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015314 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU074991 MISSION® esiRNA esiRNA human AC006960.1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100425 Rosetta Predictions human pricing
NM_015314 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100425 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322084 predicted 939
2 SASI_Hs02_00322085 predicted 1411
3 SASI_Hs02_00322086 predicted 908
4 SASI_Hs02_00322087 predicted 1634
5 SASI_Hs02_00322088 predicted 582
6 SASI_Hs02_00322089 predicted 601
7 SASI_Hs02_00322090 predicted 466
8 SASI_Hs02_00322091 predicted 961
9 SASI_Hs02_00322092 predicted 1552
10 SASI_Hs02_00322093 predicted 661
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015314 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347579 predicted 1034
2 SASI_Hs01_00109097 predicted 1511
3 SASI_Hs01_00109098 predicted 1007
4 SASI_Hs01_00109099 predicted 1726
5 SASI_Hs02_00347580 predicted 681
6 SASI_Hs02_00347581 predicted 696
7 SASI_Hs02_00347582 predicted 566
8 SASI_Hs01_00109101 predicted 1060
9 SASI_Hs01_00109102 predicted 1651
10 SASI_Hs01_00109103 predicted 761
11 SASI_Hs01_00109095 predicted 647
12 SASI_Hs01_00109096 predicted 1609
13 SASI_Hs01_00109100 predicted 1145
14 SASI_Hs01_00109104 predicted 1167
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_374425
KIAA0895 MISSION shRNA Bacterial Glycerol Stock
KIAA0895
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000127952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374425.2-883s1c1
Sequence:CCGGCCTCAGTTTGAGTATGCCAATCTCGAGATTGGCATACTCAAACTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374425.2-506s1c1
Sequence:CCGGCCAGCAAATCTCCTAACACTTCTCGAGAAGTGTTAGGAGATTTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_374425
KIAA0895 MISSION shRNA shRNA Plasmid DNA
KIAA0895
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000127952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374425.2-883s1c1
Sequence:CCGGCCTCAGTTTGAGTATGCCAATCTCGAGATTGGCATACTCAAACTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374425.2-506s1c1
Sequence:CCGGCCAGCAAATCTCCTAACACTTCTCGAGAAGTGTTAGGAGATTTGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_374425
KIAA0895 MISSION shRNA Lentiviral Transduction Particles
KIAA0895
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000127952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374425.2-883s1c1
Sequence:CCGGCCTCAGTTTGAGTATGCCAATCTCGAGATTGGCATACTCAAACTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374425.2-506s1c1
Sequence:CCGGCCAGCAAATCTCCTAACACTTCTCGAGAAGTGTTAGGAGATTTGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015314
KIAA0895 MISSION shRNA Bacterial Glycerol Stock
KIAA0895
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000149960    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015314.1-3505s1c1
Sequence:CCGGGCAGTTCTAGTTCCTGACTTTCTCGAGAAAGTCAGGAACTAGAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015314.1-633s1c1
Sequence:CCGGGTTACAGGGAATGGCATAGTACTCGAGTACTATGCCATTCCCTGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015314.1-1385s1c1
Sequence:CCGGCCAGGTATACTTGGATGGAATCTCGAGATTCCATCCAAGTATACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015314
KIAA0895 MISSION shRNA shRNA Plasmid DNA
KIAA0895
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000149960    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015314.1-3505s1c1
Sequence:CCGGGCAGTTCTAGTTCCTGACTTTCTCGAGAAAGTCAGGAACTAGAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015314.1-633s1c1
Sequence:CCGGGTTACAGGGAATGGCATAGTACTCGAGTACTATGCCATTCCCTGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015314.1-1385s1c1
Sequence:CCGGCCAGGTATACTTGGATGGAATCTCGAGATTCCATCCAAGTATACCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015314
KIAA0895 MISSION shRNA Lentiviral Transduction Particles
KIAA0895
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000149960    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015314.1-3505s1c1
Sequence:CCGGGCAGTTCTAGTTCCTGACTTTCTCGAGAAAGTCAGGAACTAGAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015314.1-633s1c1
Sequence:CCGGGTTACAGGGAATGGCATAGTACTCGAGTACTATGCCATTCCCTGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015314.1-1385s1c1
Sequence:CCGGCCAGGTATACTTGGATGGAATCTCGAGATTCCATCCAAGTATACCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)