EMAIL THIS PAGE TO A FRIEND

KIAA0895L

KIAA0895-like

128 Gene Product Result for
UniProtKB ID: Q68EN5, A2VCS8, Q8N3H9, Q8NAQ5, Q96IE5
Gene ID:
Rat(688736) hypothetical protein LOC688736
domestic guinea pig(100735937) KIAA0895-like ortholog
naked mole-rat(101719458) KIAA0895-like ortholog
sheep(101111991) KIAA0895-like ortholog
chicken(415660) KIAA0895-like
domestic cat(101098271) KIAA0895-like ortholog
dog(489765) KIAA0895-like ortholog
cow(512420) KIAA0895-like ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001040715 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001040715 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001040715 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040715 Rosetta Predictions human pricing
XM_929083 Rosetta Predictions human pricing
XM_933410 Rosetta Predictions human pricing
XM_933414 Rosetta Predictions human pricing
XM_933425 Rosetta Predictions human pricing
XM_933430 Rosetta Predictions human pricing
XM_933435 Rosetta Predictions human pricing
XM_933438 Rosetta Predictions human pricing
XM_933442 Rosetta Predictions human pricing
XM_933445 Rosetta Predictions human pricing
XM_933447 Rosetta Predictions human pricing
NM_001044292 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040715 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309139 predicted 2527
2 SASI_Hs02_00309140 predicted 1130
3 SASI_Hs02_00309141 predicted 1418
4 SASI_Hs02_00309142 predicted 1757
5 SASI_Hs02_00309143 predicted 1601
6 SASI_Hs02_00309144 predicted 994
7 SASI_Hs02_00309145 predicted 2189
8 SASI_Hs02_00309146 predicted 2492
9 SASI_Hs02_00309147 predicted 1606
10 SASI_Hs02_00309148 predicted 1363
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929083 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00295421 predicted 2359
2 SASI_Hs01_00295422 predicted 2468
3 SASI_Hs01_00295423 predicted 1857
4 SASI_Hs01_00295424 predicted 1716
5 SASI_Hs01_00295425 predicted 2476
6 SASI_Hs01_00295426 predicted 1705
7 SASI_Hs01_00295427 predicted 1815
8 SASI_Hs01_00295428 predicted 2524
9 SASI_Hs01_00295429 predicted 2433
10 SASI_Hs01_00295430 predicted 1817
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933410 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00273746 predicted 303
2 SASI_Hs01_00273747 predicted 366
3 SASI_Hs01_00273748 predicted 467
4 SASI_Hs01_00273749 predicted 414
5 SASI_Hs01_00273750 predicted 416
6 SASI_Hs01_00273751 predicted 490
7 SASI_Hs01_00273752 predicted 411
8 SASI_Hs01_00273753 predicted 363
9 SASI_Hs01_00273754 predicted 366
10 SASI_Hs01_00273755 predicted 463
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933414 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00274096 predicted 1715
2 SASI_Hs01_00274097 predicted 1803
3 SASI_Hs01_00274098 predicted 1862
4 SASI_Hs01_00274099 predicted 1718
5 SASI_Hs01_00274100 predicted 1853
6 SASI_Hs01_00274101 predicted 1702
7 SASI_Hs01_00274102 predicted 1708
8 SASI_Hs01_00274103 predicted 1705
9 SASI_Hs01_00274104 predicted 1818
10 SASI_Hs01_00274105 predicted 1829
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933425 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00300180 predicted 2355
2 SASI_Hs01_00300181 predicted 2470
3 SASI_Hs01_00300182 predicted 1857
4 SASI_Hs01_00300183 predicted 1720
5 SASI_Hs01_00300184 predicted 2475
6 SASI_Hs01_00300185 predicted 1703
7 SASI_Hs01_00300186 predicted 1812
8 SASI_Hs01_00300187 predicted 2524
9 SASI_Hs01_00300188 predicted 2437
10 SASI_Hs01_00300189 predicted 1824
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933430 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00262209 predicted 377
2 SASI_Hs01_00262210 predicted 577
3 SASI_Hs01_00262211 predicted 644
4 SASI_Hs01_00262212 predicted 544
5 SASI_Hs01_00262213 predicted 628
6 SASI_Hs01_00262214 predicted 308
7 SASI_Hs01_00262215 predicted 368
8 SASI_Hs01_00262216 predicted 315
9 SASI_Hs01_00262217 predicted 375
10 SASI_Hs01_00262218 predicted 456
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933435 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00252250 predicted 1302
2 SASI_Hs01_00252251 predicted 1296
3 SASI_Hs01_00252252 predicted 1315
4 SASI_Hs01_00252253 predicted 1253
5 SASI_Hs01_00252254 predicted 1222
6 SASI_Hs01_00252255 predicted 3287
7 SASI_Hs01_00252256 predicted 2199
8 SASI_Hs01_00252257 predicted 3049
9 SASI_Hs01_00252258 predicted 2116
10 SASI_Hs01_00252259 predicted 3361
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933438 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00264829 predicted 775
2 SASI_Hs01_00264830 predicted 311
3 SASI_Hs01_00264831 predicted 969
4 SASI_Hs01_00264832 predicted 1038
5 SASI_Hs01_00264833 predicted 632
6 SASI_Hs01_00264834 predicted 762
7 SASI_Hs01_00264835 predicted 430
8 SASI_Hs01_00264836 predicted 706
9 SASI_Hs01_00264837 predicted 371
10 SASI_Hs01_00264838 predicted 901
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933442 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00294886 predicted 1290
2 SASI_Hs01_00294887 predicted 1394
3 SASI_Hs01_00294888 predicted 1340
4 SASI_Hs01_00294889 predicted 1289
5 SASI_Hs01_00294890 predicted 1337
6 SASI_Hs01_00294891 predicted 1334
7 SASI_Hs01_00294892 predicted 1331
8 SASI_Hs01_00294893 predicted 1285
9 SASI_Hs01_00294894 predicted 1409
10 SASI_Hs01_00294895 predicted 1344
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933445 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00253549 predicted 1851
2 SASI_Hs01_00253550 predicted 1946
3 SASI_Hs01_00253551 predicted 1996
4 SASI_Hs01_00253552 predicted 1856
5 SASI_Hs01_00253553 predicted 1997
6 SASI_Hs01_00253554 predicted 1843
7 SASI_Hs01_00253555 predicted 1849
8 SASI_Hs01_00253556 predicted 1851
9 SASI_Hs01_00253557 predicted 1955
10 SASI_Hs01_00253558 predicted 1974
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933447 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00265133 predicted 2110
2 SASI_Hs01_00265134 predicted 2218
3 SASI_Hs01_00265135 predicted 1611
4 SASI_Hs01_00265136 predicted 2106
5 SASI_Hs01_00265137 predicted 1601
6 SASI_Hs01_00265138 predicted 2235
7 SASI_Hs01_00265139 predicted 1562
8 SASI_Hs01_00265140 predicted 2269
9 SASI_Hs01_00265141 predicted 2191
10 SASI_Hs01_00265142 predicted 1568
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044292 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205594 predicted 720
2 SASI_Rn02_00205595 predicted 1084
3 SASI_Rn02_00205596 predicted 835
4 SASI_Rn02_00205597 predicted 675
5 SASI_Rn02_00205598 predicted 1735
6 SASI_Rn02_00205599 predicted 1453
7 SASI_Rn02_00205600 predicted 1152
8 SASI_Rn02_00205601 predicted 692
9 SASI_Rn02_00205602 predicted 982
10 SASI_Rn02_00205603 predicted 1315
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001040715
KIAA0895L MISSION shRNA Bacterial Glycerol Stock
KIAA0895-like
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000284023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040715.1-1441s21c1
Sequence:CCGGATGGTCGATTGTGCGCAAATACTCGAGTATTTGCGCACAATCGACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040715.1-2842s21c1
Sequence:CCGGCTTCTTGGAAGGCACCAATTTCTCGAGAAATTGGTGCCTTCCAAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040715.1-1982s21c1
Sequence:CCGGCATCGCCAGACCATCGATTTCCTCGAGGAAATCGATGGTCTGGCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040715.1-1245s21c1
Sequence:CCGGAGTCCCATTACACCTACAATCCTCGAGGATTGTAGGTGTAATGGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001040715
KIAA0895L MISSION shRNA shRNA Plasmid DNA
KIAA0895-like
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000284023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040715.1-1441s21c1
Sequence:CCGGATGGTCGATTGTGCGCAAATACTCGAGTATTTGCGCACAATCGACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040715.1-2842s21c1
Sequence:CCGGCTTCTTGGAAGGCACCAATTTCTCGAGAAATTGGTGCCTTCCAAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040715.1-1982s21c1
Sequence:CCGGCATCGCCAGACCATCGATTTCCTCGAGGAAATCGATGGTCTGGCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040715.1-1245s21c1
Sequence:CCGGAGTCCCATTACACCTACAATCCTCGAGGATTGTAGGTGTAATGGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001040715
KIAA0895L MISSION shRNA Lentiviral Transduction Particles
KIAA0895-like
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000284023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040715.1-1441s21c1
Sequence:CCGGATGGTCGATTGTGCGCAAATACTCGAGTATTTGCGCACAATCGACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040715.1-2842s21c1
Sequence:CCGGCTTCTTGGAAGGCACCAATTTCTCGAGAAATTGGTGCCTTCCAAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040715.1-1982s21c1
Sequence:CCGGCATCGCCAGACCATCGATTTCCTCGAGGAAATCGATGGTCTGGCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040715.1-1245s21c1
Sequence:CCGGAGTCCCATTACACCTACAATCCTCGAGGATTGTAGGTGTAATGGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)