EMAIL THIS PAGE TO A FRIEND

KIAA0907

KIAA0907

146 Gene Product Result for
Synonyms: BLOM7 RP11-336K24.1
UniProtKB ID: Q7Z7F0, O94981, Q7L7Q2, Q7Z7E9, Q8TBQ0
Gene ID:
Zebrafish(321686) KIAA0907 protein
cow(530205) KIAA0907 ortholog
domestic cat(101085343) KIAA0907 ortholog
dog(612936) KIAA0907 ortholog
chicken(425070) KIAA0907
sheep(101121220) KIAA0907 ortholog
domestic guinea pig(100719066) KIAA0907 ortholog
naked mole-rat(101697740) KIAA0907 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014949 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014949 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014949 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU018171 MISSION® esiRNA esiRNA targeting human KIAA0907 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014949 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014949 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137954 predicted 789
2 SASI_Hs01_00137955 predicted 887
3 SASI_Hs02_00346626 predicted 257
4 SASI_Hs01_00137956 predicted 1019
5 SASI_Hs01_00137957 predicted 1643
6 SASI_Hs01_00137958 predicted 807
7 SASI_Hs01_00137959 predicted 1004
8 SASI_Hs01_00137960 predicted 519
9 SASI_Hs01_00137961 predicted 985
10 SASI_Hs01_00137962 predicted 1698
11 SASI_Hs01_00137963 predicted 791
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014949
VALIDATED
KIAA0907 MISSION shRNA Bacterial Glycerol Stock
KIAA0907
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014949.2-2237s21c1
Sequence:CCGGTTACTACTGTTTGGTCAATTTCTCGAGAAATTGACCAAACAGTAGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014949.2-402s21c1
Sequence:CCGGAGACGAGATCAGCCGACTTAGCTCGAGCTAAGTCGGCTGATCTCGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145054    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014949.2-2202s1c1
Sequence:CCGGCCCAGTTCTGACATAAAGAAACTCGAGTTTCTTTATGTCAGAACTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014949.2-216s1c1
Sequence:CCGGCAAGATTAATGCCATGCTCATCTCGAGATGAGCATGGCATTAATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014949.2-1482s1c1
Sequence:CCGGGACTAATTTAGGTACAGGCTTCTCGAGAAGCCTGTACCTAAATTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014949.2-1662s1c1
Sequence:CCGGGAGCCATGATTATCCAGCCAACTCGAGTTGGCTGGATAATCATGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141096    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014949.2-2633s1c1
Sequence:CCGGCCAGAACTGGTTGCAGCTAAACTCGAGTTTAGCTGCAACCAGTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_014949.2-1037s1c1
Sequence:CCGGGCTATACACAACCCTCTGCTACTCGAGTAGCAGAGGGTTGTGTATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142011    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014949.2-2534s1c1
Sequence:CCGGGCCCTTCTAAGATCCTGTCTTCTCGAGAAGACAGGATCTTAGAAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_014949.2-1832s1c1
Sequence:CCGGGAGCTAAACAACAGATGCCATCTCGAGATGGCATCTGTTGTTTAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014949.2-1794s1c1
Sequence:CCGGCTGGAGTTTGGGATACCAATACTCGAGTATTGGTATCCCAAACTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014949
VALIDATED
KIAA0907 MISSION shRNA shRNA Plasmid DNA
KIAA0907
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014949.2-2237s21c1
Sequence:CCGGTTACTACTGTTTGGTCAATTTCTCGAGAAATTGACCAAACAGTAGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014949.2-402s21c1
Sequence:CCGGAGACGAGATCAGCCGACTTAGCTCGAGCTAAGTCGGCTGATCTCGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145054    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014949.2-2202s1c1
Sequence:CCGGCCCAGTTCTGACATAAAGAAACTCGAGTTTCTTTATGTCAGAACTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014949.2-216s1c1
Sequence:CCGGCAAGATTAATGCCATGCTCATCTCGAGATGAGCATGGCATTAATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014949.2-1482s1c1
Sequence:CCGGGACTAATTTAGGTACAGGCTTCTCGAGAAGCCTGTACCTAAATTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014949.2-1662s1c1
Sequence:CCGGGAGCCATGATTATCCAGCCAACTCGAGTTGGCTGGATAATCATGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141096    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014949.2-2633s1c1
Sequence:CCGGCCAGAACTGGTTGCAGCTAAACTCGAGTTTAGCTGCAACCAGTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_014949.2-1037s1c1
Sequence:CCGGGCTATACACAACCCTCTGCTACTCGAGTAGCAGAGGGTTGTGTATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142011    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014949.2-2534s1c1
Sequence:CCGGGCCCTTCTAAGATCCTGTCTTCTCGAGAAGACAGGATCTTAGAAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_014949.2-1832s1c1
Sequence:CCGGGAGCTAAACAACAGATGCCATCTCGAGATGGCATCTGTTGTTTAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014949.2-1794s1c1
Sequence:CCGGCTGGAGTTTGGGATACCAATACTCGAGTATTGGTATCCCAAACTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014949
VALIDATED
KIAA0907 MISSION shRNA Lentiviral Transduction Particles
KIAA0907
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014949.2-2237s21c1
Sequence:CCGGTTACTACTGTTTGGTCAATTTCTCGAGAAATTGACCAAACAGTAGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014949.2-402s21c1
Sequence:CCGGAGACGAGATCAGCCGACTTAGCTCGAGCTAAGTCGGCTGATCTCGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145054    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014949.2-2202s1c1
Sequence:CCGGCCCAGTTCTGACATAAAGAAACTCGAGTTTCTTTATGTCAGAACTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014949.2-216s1c1
Sequence:CCGGCAAGATTAATGCCATGCTCATCTCGAGATGAGCATGGCATTAATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014949.2-1482s1c1
Sequence:CCGGGACTAATTTAGGTACAGGCTTCTCGAGAAGCCTGTACCTAAATTAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014949.2-1662s1c1
Sequence:CCGGGAGCCATGATTATCCAGCCAACTCGAGTTGGCTGGATAATCATGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141096    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014949.2-2633s1c1
Sequence:CCGGCCAGAACTGGTTGCAGCTAAACTCGAGTTTAGCTGCAACCAGTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_014949.2-1037s1c1
Sequence:CCGGGCTATACACAACCCTCTGCTACTCGAGTAGCAGAGGGTTGTGTATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142011    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014949.2-2534s1c1
Sequence:CCGGGCCCTTCTAAGATCCTGTCTTCTCGAGAAGACAGGATCTTAGAAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_014949.2-1832s1c1
Sequence:CCGGGAGCTAAACAACAGATGCCATCTCGAGATGGCATCTGTTGTTTAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014949.2-1794s1c1
Sequence:CCGGCTGGAGTTTGGGATACCAATACTCGAGTATTGGTATCCCAAACTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)