EMAIL THIS PAGE TO A FRIEND

KIAA0930

KIAA0930

68 Gene Product Result for
Synonyms: C22orf9
Gene ID:
sheep(101108740) KIAA0930 ortholog
domestic guinea pig(100720823) KIAA0930 ortholog
naked mole-rat(101701609) KIAA0930 ortholog
chicken(418241) KIAA0930
cow(100138505) KIAA0930 ortholog
domestic cat(101094610) KIAA0930 ortholog
dog(481210) KIAA0930 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100292 Anti-C22ORF9 antibody produced in rabbit affinity isolated antibody guinea pig, human, mouse, rat, rabbit, horse,
western blot pricing
HPA038091 Anti-KIAA0930 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015264 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015264 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015264 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009880 Rosetta Predictions human pricing
NM_015264 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009880 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156189 predicted 610
2 SASI_Hs01_00156190 predicted 695
3 SASI_Hs01_00156191 predicted 364
4 SASI_Hs01_00156192 predicted 750
5 SASI_Hs01_00156194 predicted 346
6 SASI_Hs01_00156195 predicted 1030
7 SASI_Hs01_00156196 predicted 447
8 SASI_Hs01_00156197 predicted 1723
9 SASI_Hs01_00156198 predicted 687
10 SASI_Hs02_00305694 predicted 758
11 SASI_Hs01_00156193 predicted 1161
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015264 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063008 predicted 681
2 SASI_Hs01_00063009 predicted 763
3 SASI_Hs01_00063010 predicted 431
4 SASI_Hs01_00063011 predicted 822
5 SASI_Hs01_00063013 predicted 424
6 SASI_Hs01_00063014 predicted 1110
7 SASI_Hs01_00063015 predicted 515
8 SASI_Hs01_00063016 predicted 1799
9 SASI_Hs01_00063017 predicted 756
10 SASI_Hs02_00347416 predicted 827
11 SASI_Hs01_00063012 predicted 1238
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015264
VALIDATED
KIAA0930 MISSION shRNA Bacterial Glycerol Stock
KIAA0930
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015264.1-1155s1c1
Sequence:CCGGCGATCTGCACAATGCAACCAACTCGAGTTGGTTGCATTGTGCAGATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015264.1-852s1c1
Sequence:CCGGCAACATGGAGTTTGTGCGCATCTCGAGATGCGCACAAACTCCATGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015264.1-917s1c1
Sequence:CCGGGAGTGTCTACAGGTGACACATCTCGAGATGTGTCACCTGTAGACACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015264.1-240s1c1
Sequence:CCGGGATGTTCTCCACCTACTTCATCTCGAGATGAAGTAGGTGGAGAACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159289    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015264.1-3956s1c1
Sequence:CCGGGCACATTTGTACTTCTTGTAACTCGAGTTACAAGAAGTACAAATGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015264.1-627s1c1
Sequence:CCGGCTTCTTCATGATTGACAGCTTCTCGAGAAGCTGTCAATCATGAAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015264.1-825s1c1
Sequence:CCGGGATGTCGTTTGGCTTCTACAACTCGAGTTGTAGAAGCCAAACGACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015264.1-453s1c1
Sequence:CCGGCCTGAATCTCATCCTGCAGAACTCGAGTTCTGCAGGATGAGATTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015264.1-1228s1c1
Sequence:CCGGCTGAAGCTGAACAGAGCAGATCTCGAGATCTGCTCTGTTCAGCTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015264.1-225s1c1
Sequence:CCGGCGTCTTCTGGACTTGGATGTTCTCGAGAACATCCAAGTCCAGAAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133660    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015264.1-2958s1c1
Sequence:CCGGGCACGATTTCATGTTCCTAAACTCGAGTTTAGGAACATGAAATCGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015264.1-619s1c1
Sequence:CCGGCCCAACATCTTCTTCATGATTCTCGAGAATCATGAAGAAGATGTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015264
VALIDATED
KIAA0930 MISSION shRNA shRNA Plasmid DNA
KIAA0930
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015264.1-1155s1c1
Sequence:CCGGCGATCTGCACAATGCAACCAACTCGAGTTGGTTGCATTGTGCAGATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015264.1-852s1c1
Sequence:CCGGCAACATGGAGTTTGTGCGCATCTCGAGATGCGCACAAACTCCATGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015264.1-917s1c1
Sequence:CCGGGAGTGTCTACAGGTGACACATCTCGAGATGTGTCACCTGTAGACACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015264.1-240s1c1
Sequence:CCGGGATGTTCTCCACCTACTTCATCTCGAGATGAAGTAGGTGGAGAACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159289    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015264.1-3956s1c1
Sequence:CCGGGCACATTTGTACTTCTTGTAACTCGAGTTACAAGAAGTACAAATGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015264.1-627s1c1
Sequence:CCGGCTTCTTCATGATTGACAGCTTCTCGAGAAGCTGTCAATCATGAAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015264.1-825s1c1
Sequence:CCGGGATGTCGTTTGGCTTCTACAACTCGAGTTGTAGAAGCCAAACGACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015264.1-453s1c1
Sequence:CCGGCCTGAATCTCATCCTGCAGAACTCGAGTTCTGCAGGATGAGATTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015264.1-1228s1c1
Sequence:CCGGCTGAAGCTGAACAGAGCAGATCTCGAGATCTGCTCTGTTCAGCTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015264.1-225s1c1
Sequence:CCGGCGTCTTCTGGACTTGGATGTTCTCGAGAACATCCAAGTCCAGAAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133660    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015264.1-2958s1c1
Sequence:CCGGGCACGATTTCATGTTCCTAAACTCGAGTTTAGGAACATGAAATCGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015264.1-619s1c1
Sequence:CCGGCCCAACATCTTCTTCATGATTCTCGAGAATCATGAAGAAGATGTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015264
VALIDATED
KIAA0930 MISSION shRNA Lentiviral Transduction Particles
KIAA0930
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015264.1-1155s1c1
Sequence:CCGGCGATCTGCACAATGCAACCAACTCGAGTTGGTTGCATTGTGCAGATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015264.1-852s1c1
Sequence:CCGGCAACATGGAGTTTGTGCGCATCTCGAGATGCGCACAAACTCCATGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015264.1-917s1c1
Sequence:CCGGGAGTGTCTACAGGTGACACATCTCGAGATGTGTCACCTGTAGACACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015264.1-240s1c1
Sequence:CCGGGATGTTCTCCACCTACTTCATCTCGAGATGAAGTAGGTGGAGAACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159289    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015264.1-3956s1c1
Sequence:CCGGGCACATTTGTACTTCTTGTAACTCGAGTTACAAGAAGTACAAATGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015264.1-627s1c1
Sequence:CCGGCTTCTTCATGATTGACAGCTTCTCGAGAAGCTGTCAATCATGAAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015264.1-825s1c1
Sequence:CCGGGATGTCGTTTGGCTTCTACAACTCGAGTTGTAGAAGCCAAACGACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015264.1-453s1c1
Sequence:CCGGCCTGAATCTCATCCTGCAGAACTCGAGTTCTGCAGGATGAGATTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015264.1-1228s1c1
Sequence:CCGGCTGAAGCTGAACAGAGCAGATCTCGAGATCTGCTCTGTTCAGCTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015264.1-225s1c1
Sequence:CCGGCGTCTTCTGGACTTGGATGTTCTCGAGAACATCCAAGTCCAGAAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133660    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015264.1-2958s1c1
Sequence:CCGGGCACGATTTCATGTTCCTAAACTCGAGTTTAGGAACATGAAATCGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015264.1-619s1c1
Sequence:CCGGCCCAACATCTTCTTCATGATTCTCGAGAATCATGAAGAAGATGTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)