EMAIL THIS PAGE TO A FRIEND

KIAA0947

KIAA0947

74 Gene Product Result for
UniProtKB ID: Q9Y2F5, Q68DE1, Q6ZT40, Q7L587, Q7Z3A9, Q9NTH9
Gene ID:
chicken(420795) KIAA0947 ortholog
domestic cat(101099863) KIAA0947 ortholog
cow(782502) KIAA0947 ortholog
dog(488059) KIAA0947 ortholog
domestic guinea pig(100712881) KIAA0947 ortholog
naked mole-rat(101713077) KIAA0947 ortholog
sheep(101107734) KIAA0947 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015325 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015325 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015325 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU049281 MISSION® esiRNA esiRNA human AC012607.8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015325 Rosetta Predictions human pricing
XM_029101 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015325 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347604 predicted 3652
2 SASI_Hs02_00347605 predicted 4556
3 SASI_Hs02_00347606 predicted 536
4 SASI_Hs02_00347607 predicted 1117
5 SASI_Hs02_00347608 predicted 4814
6 SASI_Hs02_00347609 predicted 1906
7 SASI_Hs02_00347610 predicted 6681
8 SASI_Hs02_00347611 predicted 4429
9 SASI_Hs02_00347612 predicted 2650
10 SASI_Hs02_00347613 predicted 2855
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_029101 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00296724 predicted 4308
2 SASI_Hs01_00296725 predicted 2992
3 SASI_Hs01_00296726 predicted 5211
4 SASI_Hs01_00296727 predicted 5382
5 SASI_Hs01_00296728 predicted 1194
6 SASI_Hs01_00296729 predicted 1774
7 SASI_Hs01_00296730 predicted 4468
8 SASI_Hs01_00296731 predicted 5468
9 SASI_Hs01_00296732 predicted 2560
10 SASI_Hs01_00296733 predicted 7329
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015325
VALIDATED
KIAA0947 MISSION shRNA Bacterial Glycerol Stock
KIAA0947
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_015325.1-4739s21c1
Sequence:CCGGATAAGAGTCGTTTGCGAAATACTCGAGTATTTCGCAAACGACTCTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_015325.1-2784s21c1
Sequence:CCGGGCCTAATCAAGTATCAGTTATCTCGAGATAACTGATACTTGATTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015325.1-1911s21c1
Sequence:CCGGTACTAAGTGGACACGAATTAACTCGAGTTAATTCGTGTCCACTTAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_015325.1-4761s21c1
Sequence:CCGGACCCGTTAAGCCTAGTATATGCTCGAGCATATACTAGGCTTAACGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264170    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_015325.1-7512s21c1
Sequence:CCGGCTCAAGATGTAGTGCGTAATTCTCGAGAATTACGCACTACATCTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015325
VALIDATED
KIAA0947 MISSION shRNA shRNA Plasmid DNA
KIAA0947
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_015325.1-4739s21c1
Sequence:CCGGATAAGAGTCGTTTGCGAAATACTCGAGTATTTCGCAAACGACTCTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_015325.1-2784s21c1
Sequence:CCGGGCCTAATCAAGTATCAGTTATCTCGAGATAACTGATACTTGATTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015325.1-1911s21c1
Sequence:CCGGTACTAAGTGGACACGAATTAACTCGAGTTAATTCGTGTCCACTTAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_015325.1-4761s21c1
Sequence:CCGGACCCGTTAAGCCTAGTATATGCTCGAGCATATACTAGGCTTAACGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264170    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_015325.1-7512s21c1
Sequence:CCGGCTCAAGATGTAGTGCGTAATTCTCGAGAATTACGCACTACATCTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015325
VALIDATED
KIAA0947 MISSION shRNA Lentiviral Transduction Particles
KIAA0947
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_015325.1-4739s21c1
Sequence:CCGGATAAGAGTCGTTTGCGAAATACTCGAGTATTTCGCAAACGACTCTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_015325.1-2784s21c1
Sequence:CCGGGCCTAATCAAGTATCAGTTATCTCGAGATAACTGATACTTGATTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015325.1-1911s21c1
Sequence:CCGGTACTAAGTGGACACGAATTAACTCGAGTTAATTCGTGTCCACTTAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_015325.1-4761s21c1
Sequence:CCGGACCCGTTAAGCCTAGTATATGCTCGAGCATATACTAGGCTTAACGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264170    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_015325.1-7512s21c1
Sequence:CCGGCTCAAGATGTAGTGCGTAATTCTCGAGAATTACGCACTACATCTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)