EMAIL THIS PAGE TO A FRIEND

KIAA1024

KIAA1024

211 Gene Product Result for
UniProtKB ID: Q9UPX6, A7MD43
Gene ID:
domestic guinea pig(100732703) KIAA1024 ortholog
naked mole-rat(101701300) KIAA1024 ortholog
sheep(101113798) KIAA1024 ortholog
chicken(415485) KIAA1024
cow(541059) KIAA1024 ortholog
domestic cat(101093439) KIAA1024 ortholog
dog(610163) KIAA1024 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA011545 Anti-KIAA1024 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB2101251 Anti-KIAA1024 antibody produced in rabbit affinity isolated antibody dog, mouse, human, rat, bovine
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015206 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015206 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015206 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU006011 MISSION® esiRNA esiRNA targeting human KIAA1024 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015206 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015206 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134010 predicted 1067
2 SASI_Hs01_00134011 predicted 1607
3 SASI_Hs01_00134012 predicted 593
4 SASI_Hs01_00134013 predicted 1410
5 SASI_Hs01_00134014 predicted 2807
6 SASI_Hs01_00134016 predicted 2506
7 SASI_Hs01_00134017 predicted 1305
8 SASI_Hs02_00347303 predicted 1291
9 SASI_Hs01_00134018 predicted 776
10 SASI_Hs01_00134019 predicted 288
11 SASI_Hs01_00134015 predicted 615
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015206
KIAA1024 MISSION shRNA Bacterial Glycerol Stock
KIAA1024
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000140101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015206.1-1881s1c1
Sequence:CCGGGATTGGCGAAATCGAACGGAACTCGAGTTCCGTTCGATTTCGCCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015206.1-2274s1c1
Sequence:CCGGGCGCACCATCACTTATACCAACTCGAGTTGGTATAAGTGATGGTGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015206.1-1753s1c1
Sequence:CCGGCCTGAGCACAACTTAACCAAACTCGAGTTTGGTTAAGTTGTGCTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015206.1-2303s1c1
Sequence:CCGGGCCTCAATGAGGAGGAGATAACTCGAGTTATCTCCTCCTCATTGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015206.1-2092s1c1
Sequence:CCGGCCCAAACTAGAGAACAACCCTCTCGAGAGGGTTGTTCTCTAGTTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015206.2-1914s21c1
Sequence:CCGGGTCGGGTGTCCGTGATGAAATCTCGAGATTTCATCACGGACACCCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015206.2-982s21c1
Sequence:CCGGAGCTTTGAAATGCCCTATAACCTCGAGGTTATAGGGCATTTCAAAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015206.1-325s1c1
Sequence:CCGGGCAGCAGATATTGTGACGATACTCGAGTATCGTCACAATATCTGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015206.1-2686s1c1
Sequence:CCGGCCAGGATACGATTCATTACTACTCGAGTAGTAATGAATCGTATCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015206
KIAA1024 MISSION shRNA shRNA Plasmid DNA
KIAA1024
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000140101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015206.1-1881s1c1
Sequence:CCGGGATTGGCGAAATCGAACGGAACTCGAGTTCCGTTCGATTTCGCCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015206.1-2274s1c1
Sequence:CCGGGCGCACCATCACTTATACCAACTCGAGTTGGTATAAGTGATGGTGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015206.1-1753s1c1
Sequence:CCGGCCTGAGCACAACTTAACCAAACTCGAGTTTGGTTAAGTTGTGCTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015206.1-2303s1c1
Sequence:CCGGGCCTCAATGAGGAGGAGATAACTCGAGTTATCTCCTCCTCATTGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015206.1-2092s1c1
Sequence:CCGGCCCAAACTAGAGAACAACCCTCTCGAGAGGGTTGTTCTCTAGTTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015206.2-1914s21c1
Sequence:CCGGGTCGGGTGTCCGTGATGAAATCTCGAGATTTCATCACGGACACCCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015206.2-982s21c1
Sequence:CCGGAGCTTTGAAATGCCCTATAACCTCGAGGTTATAGGGCATTTCAAAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015206.1-325s1c1
Sequence:CCGGGCAGCAGATATTGTGACGATACTCGAGTATCGTCACAATATCTGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015206.1-2686s1c1
Sequence:CCGGCCAGGATACGATTCATTACTACTCGAGTAGTAATGAATCGTATCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015206
KIAA1024 MISSION shRNA Lentiviral Transduction Particles
KIAA1024
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000140101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015206.1-1881s1c1
Sequence:CCGGGATTGGCGAAATCGAACGGAACTCGAGTTCCGTTCGATTTCGCCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015206.1-2274s1c1
Sequence:CCGGGCGCACCATCACTTATACCAACTCGAGTTGGTATAAGTGATGGTGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015206.1-1753s1c1
Sequence:CCGGCCTGAGCACAACTTAACCAAACTCGAGTTTGGTTAAGTTGTGCTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015206.1-2303s1c1
Sequence:CCGGGCCTCAATGAGGAGGAGATAACTCGAGTTATCTCCTCCTCATTGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015206.1-2092s1c1
Sequence:CCGGCCCAAACTAGAGAACAACCCTCTCGAGAGGGTTGTTCTCTAGTTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015206.2-1914s21c1
Sequence:CCGGGTCGGGTGTCCGTGATGAAATCTCGAGATTTCATCACGGACACCCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015206.2-982s21c1
Sequence:CCGGAGCTTTGAAATGCCCTATAACCTCGAGGTTATAGGGCATTTCAAAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015206.1-325s1c1
Sequence:CCGGGCAGCAGATATTGTGACGATACTCGAGTATCGTCACAATATCTGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015206.1-2686s1c1
Sequence:CCGGCCAGGATACGATTCATTACTACTCGAGTAGTAATGAATCGTATCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)