EMAIL THIS PAGE TO A FRIEND

KIAA1033

KIAA1033

147 Gene Product Result for
Synonyms: SWIP
UniProtKB ID: Q2M389, Q2NL83, Q8IW61, Q8N5W7, Q9NVD6, Q9UPW7
Gene ID:
domestic guinea pig(100717417) KIAA1033 ortholog
naked mole-rat(101701347) KIAA1033 ortholog
sheep(101114433) KIAA1033 ortholog
chicken(418077) KIAA1033
domestic cat(101088857) KIAA1033 ortholog
cow(783379) KIAA1033 ortholog
dog(474533) KIAA1033 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015275 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015275 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015275 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU076351 MISSION® esiRNA esiRNA human KIAA1033 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015275 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015275 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347435 predicted 266
2 SASI_Hs01_00207181 predicted 1764
3 SASI_Hs01_00207183 predicted 857
4 SASI_Hs01_00207185 predicted 2864
5 SASI_Hs01_00207186 predicted 1560
6 SASI_Hs02_00347436 predicted 539
7 SASI_Hs01_00207187 predicted 585
8 SASI_Hs01_00207188 predicted 1572
9 SASI_Hs01_00207189 predicted 938
10 SASI_Hs02_00347437 predicted 2028
11 SASI_Hs01_00207182 predicted 1048
12 SASI_Hs01_00207184 predicted 1516
13 SASI_Hs01_00207190 predicted 2653
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015275
KIAA1033 MISSION shRNA Bacterial Glycerol Stock
KIAA1033
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145538    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015275.1-5160s1c1
Sequence:CCGGCGTCATTTCATAGCAACAGTACTCGAGTACTGTTGCTATGAAATGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015275.1-2579s1c1
Sequence:CCGGGCACGGGAATTATGAATACAACTCGAGTTGTATTCATAATTCCCGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015275.1-2047s1c1
Sequence:CCGGGAGATACTTCTGGATTGCTATCTCGAGATAGCAATCCAGAAGTATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015275.1-3094s1c1
Sequence:CCGGCGAAGGCCAAAGAATATACATCTCGAGATGTATATTCTTTGGCCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015275.1-475s1c1
Sequence:CCGGGAAGGTGATTGCCAAATTCAACTCGAGTTGAATTTGGCAATCACCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015275.1-295s1c1
Sequence:CCGGCCTTATGAACAGTCCTCTCTTCTCGAGAAGAGAGGACTGTTCATAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141250    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015275.1-3612s1c1
Sequence:CCGGCGGATGGTATTCACTGCACATCTCGAGATGTGCAGTGAATACCATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015275.1-692s1c1
Sequence:CCGGCCCTGGATGAAATTATTGATACTCGAGTATCAATAATTTCATCCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015275.1-295s21c1
Sequence:CCGGCCTTATGAACAGTCCTCTCTTCTCGAGAAGAGAGGACTGTTCATAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015275.1-3094s21c1
Sequence:CCGGCGAAGGCCAAAGAATATACATCTCGAGATGTATATTCTTTGGCCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015275.1-2047s21c1
Sequence:CCGGGAGATACTTCTGGATTGCTATCTCGAGATAGCAATCCAGAAGTATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015275.1-692s21c1
Sequence:CCGGCCCTGGATGAAATTATTGATACTCGAGTATCAATAATTTCATCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015275
KIAA1033 MISSION shRNA shRNA Plasmid DNA
KIAA1033
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145538    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015275.1-5160s1c1
Sequence:CCGGCGTCATTTCATAGCAACAGTACTCGAGTACTGTTGCTATGAAATGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015275.1-2579s1c1
Sequence:CCGGGCACGGGAATTATGAATACAACTCGAGTTGTATTCATAATTCCCGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015275.1-2047s1c1
Sequence:CCGGGAGATACTTCTGGATTGCTATCTCGAGATAGCAATCCAGAAGTATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015275.1-3094s1c1
Sequence:CCGGCGAAGGCCAAAGAATATACATCTCGAGATGTATATTCTTTGGCCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015275.1-475s1c1
Sequence:CCGGGAAGGTGATTGCCAAATTCAACTCGAGTTGAATTTGGCAATCACCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015275.1-295s1c1
Sequence:CCGGCCTTATGAACAGTCCTCTCTTCTCGAGAAGAGAGGACTGTTCATAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141250    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015275.1-3612s1c1
Sequence:CCGGCGGATGGTATTCACTGCACATCTCGAGATGTGCAGTGAATACCATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015275.1-692s1c1
Sequence:CCGGCCCTGGATGAAATTATTGATACTCGAGTATCAATAATTTCATCCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015275.1-295s21c1
Sequence:CCGGCCTTATGAACAGTCCTCTCTTCTCGAGAAGAGAGGACTGTTCATAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015275.1-3094s21c1
Sequence:CCGGCGAAGGCCAAAGAATATACATCTCGAGATGTATATTCTTTGGCCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015275.1-2047s21c1
Sequence:CCGGGAGATACTTCTGGATTGCTATCTCGAGATAGCAATCCAGAAGTATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015275.1-692s21c1
Sequence:CCGGCCCTGGATGAAATTATTGATACTCGAGTATCAATAATTTCATCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015275
KIAA1033 MISSION shRNA Lentiviral Transduction Particles
KIAA1033
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145538    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015275.1-5160s1c1
Sequence:CCGGCGTCATTTCATAGCAACAGTACTCGAGTACTGTTGCTATGAAATGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015275.1-2579s1c1
Sequence:CCGGGCACGGGAATTATGAATACAACTCGAGTTGTATTCATAATTCCCGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015275.1-2047s1c1
Sequence:CCGGGAGATACTTCTGGATTGCTATCTCGAGATAGCAATCCAGAAGTATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015275.1-3094s1c1
Sequence:CCGGCGAAGGCCAAAGAATATACATCTCGAGATGTATATTCTTTGGCCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015275.1-475s1c1
Sequence:CCGGGAAGGTGATTGCCAAATTCAACTCGAGTTGAATTTGGCAATCACCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015275.1-295s1c1
Sequence:CCGGCCTTATGAACAGTCCTCTCTTCTCGAGAAGAGAGGACTGTTCATAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141250    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015275.1-3612s1c1
Sequence:CCGGCGGATGGTATTCACTGCACATCTCGAGATGTGCAGTGAATACCATCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015275.1-692s1c1
Sequence:CCGGCCCTGGATGAAATTATTGATACTCGAGTATCAATAATTTCATCCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015275.1-295s21c1
Sequence:CCGGCCTTATGAACAGTCCTCTCTTCTCGAGAAGAGAGGACTGTTCATAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015275.1-3094s21c1
Sequence:CCGGCGAAGGCCAAAGAATATACATCTCGAGATGTATATTCTTTGGCCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015275.1-2047s21c1
Sequence:CCGGGAGATACTTCTGGATTGCTATCTCGAGATAGCAATCCAGAAGTATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015275.1-692s21c1
Sequence:CCGGCCCTGGATGAAATTATTGATACTCGAGTATCAATAATTTCATCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)