EMAIL THIS PAGE TO A FRIEND

KIAA1045

KIAA1045

26 Gene Product Result for
Synonyms: RP11-392A14.4
UniProtKB ID: Q9UPV7, B7Z253, Q58FE9, Q5T662
Gene ID:
chicken(427408) KIAA1045
cow(615254) KIAA1045 ortholog
domestic cat(101087789) KIAA1045 ortholog
dog(100682849) KIAA1045 ortholog
sheep(101119613) KIAA1045 ortholog
domestic guinea pig(100727118) KIAA1045 ortholog
naked mole-rat(101709530) KIAA1045 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015297 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015297 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015297 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150371 MISSION® esiRNA esiRNA human KIAA1045 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015297 Rosetta Predictions human pricing
XM_048592 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015297 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347498 predicted 998
2 SASI_Hs02_00347499 predicted 826
3 SASI_Hs02_00347500 predicted 1325
4 SASI_Hs02_00347501 predicted 816
5 SASI_Hs02_00347502 predicted 1522
6 SASI_Hs02_00347503 predicted 832
7 SASI_Hs02_00347504 predicted 591
8 SASI_Hs02_00347505 predicted 986
9 SASI_Hs02_00347506 predicted 844
10 SASI_Hs02_00347507 predicted 784
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_048592 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247819 predicted 1917
2 SASI_Hs01_00247820 predicted 1347
3 SASI_Hs01_00247821 predicted 1174
4 SASI_Hs01_00247822 predicted 1673
5 SASI_Hs01_00247823 predicted 1928
6 SASI_Hs01_00247824 predicted 1878
7 SASI_Hs01_00247825 predicted 1185
8 SASI_Hs01_00247826 predicted 1334
9 SASI_Hs01_00247827 predicted 1195
10 SASI_Hs01_00247828 predicted 1137
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015297
KIAA1045 MISSION shRNA Bacterial Glycerol Stock
KIAA1045
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015297.1-547s21c1
Sequence:CCGGTGATGACAAACCTCCAGAAATCTCGAGATTTCTGGAGGTTTGTCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015297.1-2819s21c1
Sequence:CCGGGGCTTCTGTTTCCAACTTAATCTCGAGATTAAGTTGGAAACAGAAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015297.1-824s21c1
Sequence:CCGGGAGACCTTTCAGCGGTGTAAACTCGAGTTTACACCGCTGAAAGGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015297.1-981s21c1
Sequence:CCGGCTGAACATCGAGGCCACATAGCTCGAGCTATGTGGCCTCGATGTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015297.1-598s21c1
Sequence:CCGGCGATGAGATGTGTGATGTTTGCTCGAGCAAACATCACACATCTCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015297
KIAA1045 MISSION shRNA shRNA Plasmid DNA
KIAA1045
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015297.1-547s21c1
Sequence:CCGGTGATGACAAACCTCCAGAAATCTCGAGATTTCTGGAGGTTTGTCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015297.1-2819s21c1
Sequence:CCGGGGCTTCTGTTTCCAACTTAATCTCGAGATTAAGTTGGAAACAGAAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015297.1-824s21c1
Sequence:CCGGGAGACCTTTCAGCGGTGTAAACTCGAGTTTACACCGCTGAAAGGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015297.1-981s21c1
Sequence:CCGGCTGAACATCGAGGCCACATAGCTCGAGCTATGTGGCCTCGATGTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015297.1-598s21c1
Sequence:CCGGCGATGAGATGTGTGATGTTTGCTCGAGCAAACATCACACATCTCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015297
KIAA1045 MISSION shRNA Lentiviral Transduction Particles
KIAA1045
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015297.1-547s21c1
Sequence:CCGGTGATGACAAACCTCCAGAAATCTCGAGATTTCTGGAGGTTTGTCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015297.1-2819s21c1
Sequence:CCGGGGCTTCTGTTTCCAACTTAATCTCGAGATTAAGTTGGAAACAGAAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015297.1-824s21c1
Sequence:CCGGGAGACCTTTCAGCGGTGTAAACTCGAGTTTACACCGCTGAAAGGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015297.1-981s21c1
Sequence:CCGGCTGAACATCGAGGCCACATAGCTCGAGCTATGTGGCCTCGATGTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015297.1-598s21c1
Sequence:CCGGCGATGAGATGTGTGATGTTTGCTCGAGCAAACATCACACATCTCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)