EMAIL THIS PAGE TO A FRIEND

KIAA1109

KIAA1109

129 Gene Product Result for
Synonyms: FSA Tweek
Gene ID:
Human(84162) Summary: This gene is located on the long arm of chromosome 4 in a region that is associated with susceptibility to celiac disease. The encoded protein is similar to a Chinese hamster protein that is associated with spermatocyte and adipocyte differentiation. The C-terminus of the protein is also similar to a Caenorhabditis elegans protein that plays a role in lipid storage. In mammals, this protein is thought to function in the regulation of epithelial growth and differentiation, and in tumor development. [provided by RefSeq, Oct 2009]
chicken(422670) KIAA1109
cow(100297914) KIAA1109 ortholog
domestic cat(101087660) KIAA1109 ortholog
dog(483843) KIAA1109 ortholog
sheep(101104528) KIAA1109 ortholog
domestic guinea pig(100723398) KIAA1109 ortholog
naked mole-rat(101719634) KIAA1109 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA038076 Anti-KIAA1109 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015312 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015312 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015312 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU140921 MISSION® esiRNA esiRNA human KIAA1109 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015312 Rosetta Predictions human pricing
XM_371706 Rosetta Predictions human pricing
XM_934076 Rosetta Predictions human pricing
XM_934079 Rosetta Predictions human pricing
XM_934081 Rosetta Predictions human pricing
XM_934084 Rosetta Predictions human pricing
XM_934087 Rosetta Predictions human pricing
XM_934092 Rosetta Predictions human pricing
XM_934095 Rosetta Predictions human pricing
XM_934097 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015312 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347564 predicted 1323
2 SASI_Hs02_00347565 predicted 14457
3 SASI_Hs02_00347566 predicted 554
4 SASI_Hs02_00347567 predicted 14477
5 SASI_Hs02_00347568 predicted 3351
6 SASI_Hs02_00347569 predicted 5266
7 SASI_Hs02_00347570 predicted 10873
8 SASI_Hs02_00347571 predicted 14343
9 SASI_Hs02_00347572 predicted 5200
10 SASI_Hs02_00347573 predicted 10307
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371706 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00294210 predicted 9469
2 SASI_Hs01_00294211 predicted 9542
3 SASI_Hs01_00294212 predicted 9526
4 SASI_Hs01_00294213 predicted 9531
5 SASI_Hs01_00294214 predicted 9435
6 SASI_Hs01_00294215 predicted 9442
7 SASI_Hs01_00294216 predicted 9452
8 SASI_Hs01_00294217 predicted 9500
9 SASI_Hs01_00294218 predicted 9442
10 SASI_Hs01_00294219 predicted 9455
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934076 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00256144 predicted 1988
2 SASI_Hs01_00256145 predicted 1127
3 SASI_Hs01_00256146 predicted 607
4 SASI_Hs01_00256147 predicted 2180
5 SASI_Hs01_00256148 predicted 1588
6 SASI_Hs01_00256149 predicted 1067
7 SASI_Hs01_00256150 predicted 1614
8 SASI_Hs01_00256151 predicted 1252
9 SASI_Hs01_00256152 predicted 1474
10 SASI_Hs01_00256153 predicted 1294
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934079 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00273879 predicted 240
2 SASI_Hs01_00273880 predicted 228
3 SASI_Hs01_00273881 predicted 409
4 SASI_Hs01_00273882 predicted 485
5 SASI_Hs01_00273883 predicted 233
6 SASI_Hs01_00273884 predicted 288
7 SASI_Hs01_00273885 predicted 359
8 SASI_Hs01_00273886 predicted 206
9 SASI_Hs01_00273887 predicted 211
10 SASI_Hs01_00273888 predicted 372
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934081 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00274867 predicted 521
2 SASI_Hs01_00274868 predicted 1126
3 SASI_Hs01_00274869 predicted 1143
4 SASI_Hs01_00274870 predicted 602
5 SASI_Hs01_00274871 predicted 579
6 SASI_Hs01_00274872 predicted 1166
7 SASI_Hs01_00274873 predicted 1062
8 SASI_Hs01_00274874 predicted 1042
9 SASI_Hs01_00274875 predicted 397
10 SASI_Hs01_00274876 predicted 1246
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934084 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00257880 predicted 1099
2 SASI_Hs01_00257881 predicted 3060
3 SASI_Hs01_00257882 predicted 4234
4 SASI_Hs01_00257883 predicted 755
5 SASI_Hs01_00257884 predicted 734
6 SASI_Hs01_00257885 predicted 2749
7 SASI_Hs01_00257886 predicted 1441
8 SASI_Hs01_00257887 predicted 1373
9 SASI_Hs01_00257888 predicted 1811
10 SASI_Hs01_00257889 predicted 676
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934087 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00261827 predicted 1098
2 SASI_Hs01_00261828 predicted 3059
3 SASI_Hs01_00261829 predicted 4182
4 SASI_Hs01_00261830 predicted 754
5 SASI_Hs01_00261831 predicted 733
6 SASI_Hs01_00261832 predicted 2749
7 SASI_Hs01_00261833 predicted 1441
8 SASI_Hs01_00261834 predicted 1371
9 SASI_Hs01_00261835 predicted 1814
10 SASI_Hs01_00261836 predicted 676
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934092 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00297947 predicted 3067
2 SASI_Hs01_00297948 predicted 4179
3 SASI_Hs01_00297949 predicted 752
4 SASI_Hs01_00297950 predicted 736
5 SASI_Hs01_00297951 predicted 2754
6 SASI_Hs01_00297952 predicted 1444
7 SASI_Hs01_00297953 predicted 1373
8 SASI_Hs01_00297954 predicted 677
9 SASI_Hs01_00297955 predicted 1080
10 SASI_Hs01_00297956 predicted 4801
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934095 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00270709 predicted 3602
2 SASI_Hs01_00270710 predicted 3581
3 SASI_Hs01_00270711 predicted 3586
4 SASI_Hs01_00270712 predicted 3513
5 SASI_Hs01_00270713 predicted 3606
6 SASI_Hs01_00270714 predicted 3568
7 SASI_Hs01_00270715 predicted 3575
8 SASI_Hs01_00270716 predicted 3583
9 SASI_Hs01_00270717 predicted 3633
10 SASI_Hs01_00270718 predicted 3581
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934097 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00283274 predicted 3704
2 SASI_Hs01_00283275 predicted 3772
3 SASI_Hs01_00283276 predicted 3760
4 SASI_Hs01_00283277 predicted 3765
5 SASI_Hs01_00283278 predicted 3662
6 SASI_Hs01_00283279 predicted 3679
7 SASI_Hs01_00283280 predicted 3676
8 SASI_Hs01_00283281 predicted 3724
9 SASI_Hs01_00283282 predicted 3681
10 SASI_Hs01_00283283 predicted 3694
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015312
VALIDATED
KIAA1109 MISSION shRNA Bacterial Glycerol Stock
KIAA1109
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015312.2-3032s21c1
Sequence:CCGGCAGTAGATGGAGCCGATATTTCTCGAGAAATATCGGCTCCATCTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015312.2-5864s21c1
Sequence:CCGGCAACCGGCAGTGGCTATAATACTCGAGTATTATAGCCACTGCCGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015312.2-2456s21c1
Sequence:CCGGCCTTGCGTCCTTGGGATATTACTCGAGTAATATCCCAAGGACGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263342    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_015312.2-15284s21c1
Sequence:CCGGACTGCTTGTTATGGTTTATAACTCGAGTTATAAACCATAACAAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_015312.2-1278s21c1
Sequence:CCGGTGTAGGAGCTGGCTCATATTTCTCGAGAAATATGAGCCAGCTCCTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015312
VALIDATED
KIAA1109 MISSION shRNA shRNA Plasmid DNA
KIAA1109
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015312.2-3032s21c1
Sequence:CCGGCAGTAGATGGAGCCGATATTTCTCGAGAAATATCGGCTCCATCTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015312.2-5864s21c1
Sequence:CCGGCAACCGGCAGTGGCTATAATACTCGAGTATTATAGCCACTGCCGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015312.2-2456s21c1
Sequence:CCGGCCTTGCGTCCTTGGGATATTACTCGAGTAATATCCCAAGGACGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263342    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_015312.2-15284s21c1
Sequence:CCGGACTGCTTGTTATGGTTTATAACTCGAGTTATAAACCATAACAAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_015312.2-1278s21c1
Sequence:CCGGTGTAGGAGCTGGCTCATATTTCTCGAGAAATATGAGCCAGCTCCTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015312
VALIDATED
KIAA1109 MISSION shRNA Lentiviral Transduction Particles
KIAA1109
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015312.2-3032s21c1
Sequence:CCGGCAGTAGATGGAGCCGATATTTCTCGAGAAATATCGGCTCCATCTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015312.2-5864s21c1
Sequence:CCGGCAACCGGCAGTGGCTATAATACTCGAGTATTATAGCCACTGCCGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015312.2-2456s21c1
Sequence:CCGGCCTTGCGTCCTTGGGATATTACTCGAGTAATATCCCAAGGACGCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263342    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_015312.2-15284s21c1
Sequence:CCGGACTGCTTGTTATGGTTTATAACTCGAGTTATAAACCATAACAAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_015312.2-1278s21c1
Sequence:CCGGTGTAGGAGCTGGCTCATATTTCTCGAGAAATATGAGCCAGCTCCTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)