EMAIL THIS PAGE TO A FRIEND

KIAA1143

KIAA1143

28 Gene Product Result for
UniProtKB ID: Q96AT1, A8K0I4, Q96HJ8, Q9ULS7
Gene ID:
domestic guinea pig(100712862) KIAA1143 ortholog
naked mole-rat(101705688) KIAA1143 ortholog
sheep(101121299) KIAA1143 ortholog
chicken(420709) KIAA1143
domestic cat(101080692) KIAA1143 ortholog
cow(541014) KIAA1143 ortholog
dog(476657) KIAA1143 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020696 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020696 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020696 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU047681 MISSION® esiRNA esiRNA human KIAA1143 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020696 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020696 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110701 predicted 351
2 SASI_Hs01_00110702 predicted 326
3 SASI_Hs01_00110703 predicted 315
4 SASI_Hs01_00110704 predicted 340
5 SASI_Hs01_00110705 predicted 247
6 SASI_Hs01_00110706 predicted 236
7 SASI_Hs01_00110707 predicted 348
8 SASI_Hs01_00110708 predicted 310
9 SASI_Hs01_00110709 predicted 198
10 SASI_Hs01_00110710 predicted 308
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020696
VALIDATED
KIAA1143 MISSION shRNA Bacterial Glycerol Stock
KIAA1143
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020696.3-455s21c1
Sequence:CCGGGTAAATCAGGACTCGGTCAAACTCGAGTTTGACCGAGTCCTGATTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020696.3-350s21c1
Sequence:CCGGGCCGATGGAAGAATCATATATCTCGAGATATATGATTCTTCCATCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020696.3-3594s21c1
Sequence:CCGGAGCCTAATATAAGCCTAATATCTCGAGATATTAGGCTTATATTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020696.3-381s21c1
Sequence:CCGGTCAAGCATCCCTCAGATGAAACTCGAGTTTCATCTGAGGGATGCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020696.3-169s21c1
Sequence:CCGGACCCACCGTAGAGACTAAGAGCTCGAGCTCTTAGTCTCTACGGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168178    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020696.1-252s1c1
Sequence:CCGGCCTGTCAGTTGAAGAAGTCATCTCGAGATGACTTCTTCAACTGACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167582    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020696.1-549s1c1
Sequence:CCGGGAAAGTATATGGAGTGTTCATCTCGAGATGAACACTCCATATACTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172986    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020696.1-322s1c1
Sequence:CCGGCCAGCCGATGGAAGAATCATACTCGAGTATGATTCTTCCATCGGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020696
VALIDATED
KIAA1143 MISSION shRNA shRNA Plasmid DNA
KIAA1143
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020696.3-455s21c1
Sequence:CCGGGTAAATCAGGACTCGGTCAAACTCGAGTTTGACCGAGTCCTGATTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020696.3-350s21c1
Sequence:CCGGGCCGATGGAAGAATCATATATCTCGAGATATATGATTCTTCCATCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020696.3-3594s21c1
Sequence:CCGGAGCCTAATATAAGCCTAATATCTCGAGATATTAGGCTTATATTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020696.3-381s21c1
Sequence:CCGGTCAAGCATCCCTCAGATGAAACTCGAGTTTCATCTGAGGGATGCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020696.3-169s21c1
Sequence:CCGGACCCACCGTAGAGACTAAGAGCTCGAGCTCTTAGTCTCTACGGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168178    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020696.1-252s1c1
Sequence:CCGGCCTGTCAGTTGAAGAAGTCATCTCGAGATGACTTCTTCAACTGACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167582    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020696.1-549s1c1
Sequence:CCGGGAAAGTATATGGAGTGTTCATCTCGAGATGAACACTCCATATACTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172986    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020696.1-322s1c1
Sequence:CCGGCCAGCCGATGGAAGAATCATACTCGAGTATGATTCTTCCATCGGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020696
VALIDATED
KIAA1143 MISSION shRNA Lentiviral Transduction Particles
KIAA1143
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020696.3-455s21c1
Sequence:CCGGGTAAATCAGGACTCGGTCAAACTCGAGTTTGACCGAGTCCTGATTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020696.3-350s21c1
Sequence:CCGGGCCGATGGAAGAATCATATATCTCGAGATATATGATTCTTCCATCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020696.3-3594s21c1
Sequence:CCGGAGCCTAATATAAGCCTAATATCTCGAGATATTAGGCTTATATTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020696.3-381s21c1
Sequence:CCGGTCAAGCATCCCTCAGATGAAACTCGAGTTTCATCTGAGGGATGCTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020696.3-169s21c1
Sequence:CCGGACCCACCGTAGAGACTAAGAGCTCGAGCTCTTAGTCTCTACGGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168178    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020696.1-252s1c1
Sequence:CCGGCCTGTCAGTTGAAGAAGTCATCTCGAGATGACTTCTTCAACTGACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167582    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020696.1-549s1c1
Sequence:CCGGGAAAGTATATGGAGTGTTCATCTCGAGATGAACACTCCATATACTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172986    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020696.1-322s1c1
Sequence:CCGGCCAGCCGATGGAAGAATCATACTCGAGTATGATTCTTCCATCGGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)