EMAIL THIS PAGE TO A FRIEND

KIAA1147

KIAA1147

26 Gene Product Result for
Synonyms: LCHN PRO2561
Gene ID:
chicken(427917) KIAA1147
cow(506984) KIAA1147 ortholog
domestic cat(101092839) KIAA1147 ortholog
dog(609262) KIAA1147 ortholog
sheep(101112644) KIAA1147 ortholog
domestic guinea pig(100717489) KIAA1147 ortholog
naked mole-rat(101706379) KIAA1147 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080392 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080392 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080392 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU041821 MISSION® esiRNA esiRNA human KIAA1147 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080392 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080392 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314411 predicted 1210
2 SASI_Hs02_00314412 predicted 490
3 SASI_Hs02_00314413 predicted 536
4 SASI_Hs02_00314414 predicted 1382
5 SASI_Hs02_00314415 predicted 694
6 SASI_Hs02_00314416 predicted 747
7 SASI_Hs02_00314417 predicted 442
8 SASI_Hs02_00314418 predicted 905
9 SASI_Hs02_00314419 predicted 670
10 SASI_Hs02_00314420 predicted 1372
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080392
VALIDATED
KIAA1147 MISSION shRNA Bacterial Glycerol Stock
KIAA1147
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080392.1-331s21c1
Sequence:CCGGATGGCCAGTGGGTCCCATAAACTCGAGTTTATGGGACCCACTGGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268626    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080392.1-4800s21c1
Sequence:CCGGCATATCCATCATCCATTATAGCTCGAGCTATAATGGATGATGGATATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080392.1-990s21c1
Sequence:CCGGGTATGACGTCTACGTGGATAACTCGAGTTATCCACGTAGACGTCATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080392.1-355s21c1
Sequence:CCGGCAATCTGATTTCATCTATTTCCTCGAGGAAATAGATGAAATCAGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080392.1-758s21c1
Sequence:CCGGCCTTACTTCGAAAGCGCATTTCTCGAGAAATGCGCTTTCGAAGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080392
VALIDATED
KIAA1147 MISSION shRNA shRNA Plasmid DNA
KIAA1147
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080392.1-331s21c1
Sequence:CCGGATGGCCAGTGGGTCCCATAAACTCGAGTTTATGGGACCCACTGGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268626    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080392.1-4800s21c1
Sequence:CCGGCATATCCATCATCCATTATAGCTCGAGCTATAATGGATGATGGATATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080392.1-990s21c1
Sequence:CCGGGTATGACGTCTACGTGGATAACTCGAGTTATCCACGTAGACGTCATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080392.1-355s21c1
Sequence:CCGGCAATCTGATTTCATCTATTTCCTCGAGGAAATAGATGAAATCAGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080392.1-758s21c1
Sequence:CCGGCCTTACTTCGAAAGCGCATTTCTCGAGAAATGCGCTTTCGAAGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080392
VALIDATED
KIAA1147 MISSION shRNA Lentiviral Transduction Particles
KIAA1147
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080392.1-331s21c1
Sequence:CCGGATGGCCAGTGGGTCCCATAAACTCGAGTTTATGGGACCCACTGGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268626    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080392.1-4800s21c1
Sequence:CCGGCATATCCATCATCCATTATAGCTCGAGCTATAATGGATGATGGATATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080392.1-990s21c1
Sequence:CCGGGTATGACGTCTACGTGGATAACTCGAGTTATCCACGTAGACGTCATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080392.1-355s21c1
Sequence:CCGGCAATCTGATTTCATCTATTTCCTCGAGGAAATAGATGAAATCAGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080392.1-758s21c1
Sequence:CCGGCCTTACTTCGAAAGCGCATTTCTCGAGAAATGCGCTTTCGAAGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)