EMAIL THIS PAGE TO A FRIEND

KIAA1161

KIAA1161

83 Gene Product Result for
Synonyms: NET37
UniProtKB ID: Q6NSJ0, Q5T587, Q5T588, Q9ULQ9
Gene ID:
domestic guinea pig(100721804) KIAA1161 ortholog
naked mole-rat(101702812) KIAA1161 ortholog
sheep(101117480) KIAA1161 ortholog
chicken(427401) KIAA1161
dog(474747) KIAA1161 ortholog
cow(528987) KIAA1161 ortholog
domestic cat(101082349) KIAA1161 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020702 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020702 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020702 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU005251 MISSION® esiRNA esiRNA targeting human KIAA1161 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020702 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020702 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353706 predicted 2419
2 SASI_Hs01_00100391 predicted 1905
3 SASI_Hs01_00100392 predicted 1235
4 SASI_Hs01_00100393 predicted 1814
5 SASI_Hs01_00100396 predicted 1804
6 SASI_Hs01_00100395 predicted 2402
7 SASI_Hs02_00353707 predicted 2277
8 SASI_Hs02_00353708 predicted 2342
9 SASI_Hs01_00100397 predicted 2252
10 SASI_Hs01_00100398 predicted 2110
11 SASI_Hs01_00100394 predicted 1667
12 SASI_Hs01_00100399 predicted 2156
13 SASI_Hs01_00100400 predicted 1195
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020702
KIAA1161 MISSION shRNA Bacterial Glycerol Stock
KIAA1161
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020702.3-2278s21c1
Sequence:CCGGTGGATGAGATCGCCTACTTTACTCGAGTAAAGTAGGCGATCTCATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020702.1-433s1c1
Sequence:CCGGCTTCTCCATCCGCAATCAGAACTCGAGTTCTGATTGCGGATGGAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020702.1-3633s1c1
Sequence:CCGGCCTCCCAAAGTGTTGGGATTACTCGAGTAATCCCAACACTTTGGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020702.1-565s1c1
Sequence:CCGGGCACTTCTTCATCCAGACTGTCTCGAGACAGTCTGGATGAAGAAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020702.3-1257s21c1
Sequence:CCGGGACTTCGATGAGGTCAAATTCCTCGAGGAATTTGACCTCATCGAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020702.1-280s1c1
Sequence:CCGGCAAGCCTTCCAAAGAGCTGAACTCGAGTTCAGCTCTTTGGAAGGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020702.1-1032s1c1
Sequence:CCGGGCTACTTCAACAAGCCGTCAACTCGAGTTGACGGCTTGTTGAAGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020702.1-1774s1c1
Sequence:CCGGCCCATTCATCCTACCCGATATCTCGAGATATCGGGTAGGATGAATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020702.3-2408s21c1
Sequence:CCGGACCTCTATACCACCCATTAAGCTCGAGCTTAATGGGTGGTATAGAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152807    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020702.1-2888s1c1
Sequence:CCGGGCCATCATCATGTTCCCAATTCTCGAGAATTGGGAACATGATGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020702
KIAA1161 MISSION shRNA shRNA Plasmid DNA
KIAA1161
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020702.3-2278s21c1
Sequence:CCGGTGGATGAGATCGCCTACTTTACTCGAGTAAAGTAGGCGATCTCATCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020702.1-433s1c1
Sequence:CCGGCTTCTCCATCCGCAATCAGAACTCGAGTTCTGATTGCGGATGGAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020702.1-3633s1c1
Sequence:CCGGCCTCCCAAAGTGTTGGGATTACTCGAGTAATCCCAACACTTTGGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020702.1-565s1c1
Sequence:CCGGGCACTTCTTCATCCAGACTGTCTCGAGACAGTCTGGATGAAGAAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020702.3-1257s21c1
Sequence:CCGGGACTTCGATGAGGTCAAATTCCTCGAGGAATTTGACCTCATCGAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020702.1-280s1c1
Sequence:CCGGCAAGCCTTCCAAAGAGCTGAACTCGAGTTCAGCTCTTTGGAAGGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020702.1-1032s1c1
Sequence:CCGGGCTACTTCAACAAGCCGTCAACTCGAGTTGACGGCTTGTTGAAGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020702.1-1774s1c1
Sequence:CCGGCCCATTCATCCTACCCGATATCTCGAGATATCGGGTAGGATGAATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020702.3-2408s21c1
Sequence:CCGGACCTCTATACCACCCATTAAGCTCGAGCTTAATGGGTGGTATAGAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152807    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020702.1-2888s1c1
Sequence:CCGGGCCATCATCATGTTCCCAATTCTCGAGAATTGGGAACATGATGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020702
KIAA1161 MISSION shRNA Lentiviral Transduction Particles
KIAA1161
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020702.3-2278s21c1
Sequence:CCGGTGGATGAGATCGCCTACTTTACTCGAGTAAAGTAGGCGATCTCATCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020702.1-433s1c1
Sequence:CCGGCTTCTCCATCCGCAATCAGAACTCGAGTTCTGATTGCGGATGGAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020702.1-3633s1c1
Sequence:CCGGCCTCCCAAAGTGTTGGGATTACTCGAGTAATCCCAACACTTTGGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020702.1-565s1c1
Sequence:CCGGGCACTTCTTCATCCAGACTGTCTCGAGACAGTCTGGATGAAGAAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020702.3-1257s21c1
Sequence:CCGGGACTTCGATGAGGTCAAATTCCTCGAGGAATTTGACCTCATCGAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020702.1-280s1c1
Sequence:CCGGCAAGCCTTCCAAAGAGCTGAACTCGAGTTCAGCTCTTTGGAAGGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020702.1-1032s1c1
Sequence:CCGGGCTACTTCAACAAGCCGTCAACTCGAGTTGACGGCTTGTTGAAGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020702.1-1774s1c1
Sequence:CCGGCCCATTCATCCTACCCGATATCTCGAGATATCGGGTAGGATGAATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020702.3-2408s21c1
Sequence:CCGGACCTCTATACCACCCATTAAGCTCGAGCTTAATGGGTGGTATAGAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152807    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020702.1-2888s1c1
Sequence:CCGGGCCATCATCATGTTCCCAATTCTCGAGAATTGGGAACATGATGATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)