EMAIL THIS PAGE TO A FRIEND

KIAA1199

KIAA1199

68 Gene Product Result for
Synonyms: CCSP1 TMEM2L
UniProtKB ID: Q8WUJ3, Q6L9J5, Q9H1K5, Q9NPN9, Q9ULM1
Gene ID:
domestic guinea pig(100720639) KIAA1199 ortholog
naked mole-rat(101714296) KIAA1199 ortholog
sheep(101116178) KIAA1199 ortholog
chicken(415476) KIAA1199
cow(519047) KIAA1199 ortholog
domestic cat(101094181) KIAA1199 ortholog
dog(488766) KIAA1199 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018689 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018689 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018689 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU068761 MISSION® esiRNA esiRNA human KIAA1199 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018689 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018689 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352207 predicted 1348
2 SASI_Hs02_00352208 predicted 3031
3 SASI_Hs01_00241046 predicted 3049
4 SASI_Hs01_00241047 predicted 4104
5 SASI_Hs01_00241048 predicted 648
6 SASI_Hs01_00241050 predicted 1792
7 SASI_Hs01_00241051 predicted 3372
8 SASI_Hs01_00241052 predicted 2446
9 SASI_Hs01_00241053 predicted 1315
10 SASI_Hs01_00241054 predicted 3733
11 SASI_Hs01_00241049 predicted 1973
12 SASI_Hs01_00241055 predicted 1359
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018689
KIAA1199 MISSION shRNA Bacterial Glycerol Stock
KIAA1199
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018689.1-3302s1c1
Sequence:CCGGGCGAATGAAGATCATCAAGAACTCGAGTTCTTGATGATCTTCATTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018689.1-2396s1c1
Sequence:CCGGCCCAGGTTATTCAGAGCACATCTCGAGATGTGCTCTGAATAACCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118787    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018689.1-6640s1c1
Sequence:CCGGCCAGGAATGTTGAATGTCTTTCTCGAGAAAGACATTCAACATTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018689.1-3303s1c1
Sequence:CCGGCGAATGAAGATCATCAAGAATCTCGAGATTCTTGATGATCTTCATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018689.1-1347s1c1
Sequence:CCGGGCCACTACAATGGATGGAGTTCTCGAGAACTCCATCCATTGTAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018689
KIAA1199 MISSION shRNA shRNA Plasmid DNA
KIAA1199
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018689.1-3302s1c1
Sequence:CCGGGCGAATGAAGATCATCAAGAACTCGAGTTCTTGATGATCTTCATTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018689.1-2396s1c1
Sequence:CCGGCCCAGGTTATTCAGAGCACATCTCGAGATGTGCTCTGAATAACCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118787    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018689.1-6640s1c1
Sequence:CCGGCCAGGAATGTTGAATGTCTTTCTCGAGAAAGACATTCAACATTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018689.1-3303s1c1
Sequence:CCGGCGAATGAAGATCATCAAGAATCTCGAGATTCTTGATGATCTTCATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018689.1-1347s1c1
Sequence:CCGGGCCACTACAATGGATGGAGTTCTCGAGAACTCCATCCATTGTAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018689
KIAA1199 MISSION shRNA Lentiviral Transduction Particles
KIAA1199
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018689.1-3302s1c1
Sequence:CCGGGCGAATGAAGATCATCAAGAACTCGAGTTCTTGATGATCTTCATTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018689.1-2396s1c1
Sequence:CCGGCCCAGGTTATTCAGAGCACATCTCGAGATGTGCTCTGAATAACCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118787    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018689.1-6640s1c1
Sequence:CCGGCCAGGAATGTTGAATGTCTTTCTCGAGAAAGACATTCAACATTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018689.1-3303s1c1
Sequence:CCGGCGAATGAAGATCATCAAGAATCTCGAGATTCTTGATGATCTTCATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018689.1-1347s1c1
Sequence:CCGGGCCACTACAATGGATGGAGTTCTCGAGAACTCCATCCATTGTAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)