EMAIL THIS PAGE TO A FRIEND

KIAA1210

KIAA1210

174 Gene Product Result for
UniProtKB ID: Q9ULL0, B7ZCI8, Q5JPN4
Gene ID:
chicken(422374) KIAA1210
cow(530513) KIAA1210 ortholog
domestic cat(101092090) KIAA1210 ortholog
dog(492091) KIAA1210 ortholog
sheep(101106573) KIAA1210 ortholog
domestic guinea pig(101789173) KIAA1210 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020721 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020721 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020721 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU230211 MISSION® esiRNA esiRNA targeting human KIAA1210 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020721 Rosetta Predictions human pricing
XM_172801 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020721 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353757 predicted 4394
2 SASI_Hs02_00353758 predicted 4170
3 SASI_Hs02_00353759 predicted 3496
4 SASI_Hs02_00353760 predicted 3010
5 SASI_Hs02_00353761 predicted 1853
6 SASI_Hs02_00353762 predicted 4815
7 SASI_Hs02_00353763 predicted 370
8 SASI_Hs02_00353764 predicted 1552
9 SASI_Hs02_00353765 predicted 982
10 SASI_Hs02_00353766 predicted 3125
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_172801 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00258720 predicted 3984
2 SASI_Hs01_00258721 predicted 3765
3 SASI_Hs01_00258722 predicted 3303
4 SASI_Hs01_00258723 predicted 3085
5 SASI_Hs01_00258724 predicted 2589
6 SASI_Hs01_00258725 predicted 1442
7 SASI_Hs01_00258726 predicted 4406
8 SASI_Hs01_00258727 predicted 2366
9 SASI_Hs01_00258728 predicted 1132
10 SASI_Hs01_00258729 predicted 563
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020721
KIAA1210 MISSION shRNA Bacterial Glycerol Stock
KIAA1210
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020721.1-5931s21c1
Sequence:CCGGCTAGATAGATGCCGCAATTATCTCGAGATAATTGCGGCATCTATCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020721.1-1710s21c1
Sequence:CCGGTGGGTCTTCACCTACCAATAACTCGAGTTATTGGTAGGTGAAGACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020721.1-4824s21c1
Sequence:CCGGTGAGACTAAGGAGCCTAAATACTCGAGTATTTAGGCTCCTTAGTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020721.1-217s21c1
Sequence:CCGGGACCTGGAAATACCTAGTTATCTCGAGATAACTAGGTATTTCCAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020721.1-5111s21c1
Sequence:CCGGTGGCAGAAATCACGCAATAAACTCGAGTTTATTGCGTGATTTCTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020721
KIAA1210 MISSION shRNA shRNA Plasmid DNA
KIAA1210
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020721.1-5931s21c1
Sequence:CCGGCTAGATAGATGCCGCAATTATCTCGAGATAATTGCGGCATCTATCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020721.1-1710s21c1
Sequence:CCGGTGGGTCTTCACCTACCAATAACTCGAGTTATTGGTAGGTGAAGACCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020721.1-4824s21c1
Sequence:CCGGTGAGACTAAGGAGCCTAAATACTCGAGTATTTAGGCTCCTTAGTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020721.1-217s21c1
Sequence:CCGGGACCTGGAAATACCTAGTTATCTCGAGATAACTAGGTATTTCCAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020721.1-5111s21c1
Sequence:CCGGTGGCAGAAATCACGCAATAAACTCGAGTTTATTGCGTGATTTCTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020721
KIAA1210 MISSION shRNA Lentiviral Transduction Particles
KIAA1210
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020721.1-5931s21c1
Sequence:CCGGCTAGATAGATGCCGCAATTATCTCGAGATAATTGCGGCATCTATCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020721.1-1710s21c1
Sequence:CCGGTGGGTCTTCACCTACCAATAACTCGAGTTATTGGTAGGTGAAGACCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020721.1-4824s21c1
Sequence:CCGGTGAGACTAAGGAGCCTAAATACTCGAGTATTTAGGCTCCTTAGTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020721.1-217s21c1
Sequence:CCGGGACCTGGAAATACCTAGTTATCTCGAGATAACTAGGTATTTCCAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020721.1-5111s21c1
Sequence:CCGGTGGCAGAAATCACGCAATAAACTCGAGTTTATTGCGTGATTTCTGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)