EMAIL THIS PAGE TO A FRIEND

KIAA1211

KIAA1211

40 Gene Product Result for
UniProtKB ID: Q6ZU35, Q9NTE2, Q9NTP8, Q9ULK9
Gene ID:
domestic guinea pig(100729650) KIAA1211 ortholog
naked mole-rat(101723117) KIAA1211 ortholog
chicken(422745) KIAA1211
cow(782369) KIAA1211 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020722 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020722 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020722 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU019141 MISSION® esiRNA esiRNA targeting human KIAA1211 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020722 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020722 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353767 predicted 752
2 SASI_Hs02_00353768 predicted 678
3 SASI_Hs02_00353769 predicted 2531
4 SASI_Hs02_00353770 predicted 739
5 SASI_Hs02_00353771 predicted 752
6 SASI_Hs02_00353772 predicted 452
7 SASI_Hs02_00353773 predicted 661
8 SASI_Hs02_00353774 predicted 3598
9 SASI_Hs02_00353775 predicted 3900
10 SASI_Hs02_00353776 predicted 504
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020722
VALIDATED
KIAA1211 MISSION shRNA Bacterial Glycerol Stock
KIAA1211
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020722.1-1722s21c1
Sequence:CCGGACTCCGAGGAGCCAGGTATTTCTCGAGAAATACCTGGCTCCTCGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268643    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020722.1-4540s21c1
Sequence:CCGGGTAATGGTGAAAGGATCATATCTCGAGATATGATCCTTTCACCATTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020722.1-798s21c1
Sequence:CCGGCCATCGAAAGTGTCAACTTAGCTCGAGCTAAGTTGACACTTTCGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020722.1-740s21c1
Sequence:CCGGGAGAAGGTTGCTCCCGTTAAACTCGAGTTTAACGGGAGCAACCTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020722.1-4067s21c1
Sequence:CCGGAGCGACTGTCCACAGATTATTCTCGAGAATAATCTGTGGACAGTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020722
VALIDATED
KIAA1211 MISSION shRNA shRNA Plasmid DNA
KIAA1211
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020722.1-1722s21c1
Sequence:CCGGACTCCGAGGAGCCAGGTATTTCTCGAGAAATACCTGGCTCCTCGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268643    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020722.1-4540s21c1
Sequence:CCGGGTAATGGTGAAAGGATCATATCTCGAGATATGATCCTTTCACCATTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020722.1-798s21c1
Sequence:CCGGCCATCGAAAGTGTCAACTTAGCTCGAGCTAAGTTGACACTTTCGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020722.1-740s21c1
Sequence:CCGGGAGAAGGTTGCTCCCGTTAAACTCGAGTTTAACGGGAGCAACCTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020722.1-4067s21c1
Sequence:CCGGAGCGACTGTCCACAGATTATTCTCGAGAATAATCTGTGGACAGTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020722
VALIDATED
KIAA1211 MISSION shRNA Lentiviral Transduction Particles
KIAA1211
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020722.1-1722s21c1
Sequence:CCGGACTCCGAGGAGCCAGGTATTTCTCGAGAAATACCTGGCTCCTCGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268643    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020722.1-4540s21c1
Sequence:CCGGGTAATGGTGAAAGGATCATATCTCGAGATATGATCCTTTCACCATTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020722.1-798s21c1
Sequence:CCGGCCATCGAAAGTGTCAACTTAGCTCGAGCTAAGTTGACACTTTCGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020722.1-740s21c1
Sequence:CCGGGAGAAGGTTGCTCCCGTTAAACTCGAGTTTAACGGGAGCAACCTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020722.1-4067s21c1
Sequence:CCGGAGCGACTGTCCACAGATTATTCTCGAGAATAATCTGTGGACAGTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)