EMAIL THIS PAGE TO A FRIEND

KIAA1211L

KIAA1211-like

61 Gene Product Result for
Synonyms: C2orf55
UniProtKB ID: Q6NV74
Gene ID:
chicken(100858050) KIAA1211-like ortholog
cow(525174) KIAA1211-like ortholog
domestic cat(101096559) KIAA1211-like ortholog
domestic guinea pig(100736028) KIAA1211-like ortholog
naked mole-rat(101724276) KIAA1211-like ortholog
sheep(101111874) KIAA1211-like ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207362 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207362 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207362 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_292873 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_292873 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_292873 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207362 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207362 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373928 predicted 3011
2 SASI_Hs02_00373929 predicted 472
3 SASI_Hs02_00373930 predicted 3086
4 SASI_Hs02_00373931 predicted 3269
5 SASI_Hs02_00373932 predicted 3000
6 SASI_Hs02_00373933 predicted 3248
7 SASI_Hs02_00373934 predicted 2897
8 SASI_Hs01_00160832 predicted 645
9 SASI_Hs02_00373935 predicted 3029
10 SASI_Hs02_00373936 predicted 1014
11 SASI_Hs01_00160828 predicted 985
12 SASI_Hs01_00160829 predicted 939
13 SASI_Hs01_00160830 predicted 551
14 SASI_Hs01_00160831 predicted 1016
15 SASI_Hs01_00160833 predicted 463
16 SASI_Hs01_00160834 predicted 811
17 SASI_Hs01_00160835 predicted 640
18 SASI_Hs01_00160836 predicted 2433
19 SASI_Hs01_00160837 predicted 993
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207362
KIAA1211L MISSION shRNA Bacterial Glycerol Stock
KIAA1211-like
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207362.1-450s1c1
Sequence:CCGGGAAACAAAGTCAGACGAGGAACTCGAGTTCCTCGTCTGACTTTGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207362.1-646s1c1
Sequence:CCGGCGGATTAAAGCTCTGCAGTTACTCGAGTAACTGCAGAGCTTTAATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207362.1-907s1c1
Sequence:CCGGGCTGACTTCAGTTATCCTGCACTCGAGTGCAGGATAACTGAAGTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141211    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207362.1-2898s1c1
Sequence:CCGGCCTGTGAAGCAAGCTGACTTTCTCGAGAAAGTCAGCTTGCTTCACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207362.1-821s1c1
Sequence:CCGGCCATAAAGGTCTCTGTCGTGTCTCGAGACACGACAGAGACCTTTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207362.1-556s1c1
Sequence:CCGGGCCCTTTCTCACGACAGTATTCTCGAGAATACTGTCGTGAGAAAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141858    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207362.1-3048s1c1
Sequence:CCGGGCAGTGATGATGGAGAAGGAACTCGAGTTCCTTCTCCATCATCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207362.1-460s1c1
Sequence:CCGGCAGACGAGGAATGAGGTCATTCTCGAGAATGACCTCATTCCTCGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207362.1-901s1c1
Sequence:CCGGCCAGTGGCTGACTTCAGTTATCTCGAGATAACTGAAGTCAGCCACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207362.1-346s1c1
Sequence:CCGGGAGGACAGCACAGGAAAGAAACTCGAGTTTCTTTCCTGTGCTGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207362
KIAA1211L MISSION shRNA shRNA Plasmid DNA
KIAA1211-like
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207362.1-450s1c1
Sequence:CCGGGAAACAAAGTCAGACGAGGAACTCGAGTTCCTCGTCTGACTTTGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207362.1-646s1c1
Sequence:CCGGCGGATTAAAGCTCTGCAGTTACTCGAGTAACTGCAGAGCTTTAATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207362.1-907s1c1
Sequence:CCGGGCTGACTTCAGTTATCCTGCACTCGAGTGCAGGATAACTGAAGTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141211    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207362.1-2898s1c1
Sequence:CCGGCCTGTGAAGCAAGCTGACTTTCTCGAGAAAGTCAGCTTGCTTCACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207362.1-821s1c1
Sequence:CCGGCCATAAAGGTCTCTGTCGTGTCTCGAGACACGACAGAGACCTTTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207362.1-556s1c1
Sequence:CCGGGCCCTTTCTCACGACAGTATTCTCGAGAATACTGTCGTGAGAAAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141858    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207362.1-3048s1c1
Sequence:CCGGGCAGTGATGATGGAGAAGGAACTCGAGTTCCTTCTCCATCATCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207362.1-460s1c1
Sequence:CCGGCAGACGAGGAATGAGGTCATTCTCGAGAATGACCTCATTCCTCGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207362.1-901s1c1
Sequence:CCGGCCAGTGGCTGACTTCAGTTATCTCGAGATAACTGAAGTCAGCCACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207362.1-346s1c1
Sequence:CCGGGAGGACAGCACAGGAAAGAAACTCGAGTTTCTTTCCTGTGCTGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207362
KIAA1211L MISSION shRNA Lentiviral Transduction Particles
KIAA1211-like
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207362.1-450s1c1
Sequence:CCGGGAAACAAAGTCAGACGAGGAACTCGAGTTCCTCGTCTGACTTTGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207362.1-646s1c1
Sequence:CCGGCGGATTAAAGCTCTGCAGTTACTCGAGTAACTGCAGAGCTTTAATCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207362.1-907s1c1
Sequence:CCGGGCTGACTTCAGTTATCCTGCACTCGAGTGCAGGATAACTGAAGTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141211    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207362.1-2898s1c1
Sequence:CCGGCCTGTGAAGCAAGCTGACTTTCTCGAGAAAGTCAGCTTGCTTCACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207362.1-821s1c1
Sequence:CCGGCCATAAAGGTCTCTGTCGTGTCTCGAGACACGACAGAGACCTTTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207362.1-556s1c1
Sequence:CCGGGCCCTTTCTCACGACAGTATTCTCGAGAATACTGTCGTGAGAAAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141858    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207362.1-3048s1c1
Sequence:CCGGGCAGTGATGATGGAGAAGGAACTCGAGTTCCTTCTCCATCATCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207362.1-460s1c1
Sequence:CCGGCAGACGAGGAATGAGGTCATTCTCGAGAATGACCTCATTCCTCGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207362.1-901s1c1
Sequence:CCGGCCAGTGGCTGACTTCAGTTATCTCGAGATAACTGAAGTCAGCCACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207362.1-346s1c1
Sequence:CCGGGAGGACAGCACAGGAAAGAAACTCGAGTTTCTTTCCTGTGCTGTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_292873
KIAA1211L MISSION shRNA Bacterial Glycerol Stock
KIAA1211-like
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000122121    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_292873.4-3419s1c1
Sequence:CCGGCCCAGAAACAAGAACAACATTCTCGAGAATGTTGTTCTTGTTTCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_292873
KIAA1211L MISSION shRNA shRNA Plasmid DNA
KIAA1211-like
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000122121    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_292873.4-3419s1c1
Sequence:CCGGCCCAGAAACAAGAACAACATTCTCGAGAATGTTGTTCTTGTTTCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_292873
KIAA1211L MISSION shRNA Lentiviral Transduction Particles
KIAA1211-like
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000122121    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_292873.4-3419s1c1
Sequence:CCGGCCCAGAAACAAGAACAACATTCTCGAGAATGTTGTTCTTGTTTCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)