EMAIL THIS PAGE TO A FRIEND

KIAA1217

KIAA1217

124 Gene Product Result for
Synonyms: SKT
Gene ID:
sheep(101105016) KIAA1217 ortholog
naked mole-rat(101702029) KIAA1217 ortholog
chicken(420501) KIAA1217
cow(513129) KIAA1217 ortholog
domestic cat(101085985) KIAA1217 ortholog
dog(607411) KIAA1217 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA004941 Anti-KIAA1217 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019590 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019590 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019590 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU092271 MISSION® esiRNA esiRNA human KIAA1217 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098500 Rosetta Predictions human pricing
NM_001098501 Rosetta Predictions human pricing
NM_019590 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098500 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319077 predicted 1331
2 SASI_Hs02_00319078 predicted 1934
3 SASI_Hs02_00319079 predicted 3501
4 SASI_Hs02_00319080 predicted 2747
5 SASI_Hs02_00319081 predicted 1675
6 SASI_Hs02_00319082 predicted 3517
7 SASI_Hs02_00319083 predicted 1736
8 SASI_Hs02_00319084 predicted 1166
9 SASI_Hs02_00319085 predicted 1571
10 SASI_Hs02_00319086 predicted 3381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098501 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319087 predicted 1169
2 SASI_Hs02_00319088 predicted 1760
3 SASI_Hs02_00319089 predicted 3229
4 SASI_Hs02_00319090 predicted 2482
5 SASI_Hs02_00319091 predicted 1514
6 SASI_Hs02_00319092 predicted 3246
7 SASI_Hs02_00319093 predicted 1577
8 SASI_Hs02_00319094 predicted 1000
9 SASI_Hs02_00319095 predicted 1407
10 SASI_Hs02_00319096 predicted 3113
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019590 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197111 predicted 1166
2 SASI_Hs02_00352778 predicted 1767
3 SASI_Hs02_00352779 predicted 3341
4 SASI_Hs02_00352780 predicted 2583
5 SASI_Hs02_00352781 predicted 1510
6 SASI_Hs02_00352782 predicted 3354
7 SASI_Hs01_00197118 predicted 1573
8 SASI_Hs02_00352783 predicted 1002
9 SASI_Hs02_00352784 predicted 1412
10 SASI_Hs02_00352785 predicted 3209
11 SASI_Hs01_00197112 predicted 3810
12 SASI_Hs01_00197113 predicted 5114
13 SASI_Hs01_00197114 predicted 4011
14 SASI_Hs01_00197115 predicted 1746
15 SASI_Hs01_00197116 predicted 5364
16 SASI_Hs01_00197117 predicted 5170
17 SASI_Hs01_00197119 predicted 4898
18 SASI_Hs01_00197120 predicted 3583
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019590
KIAA1217 MISSION shRNA Bacterial Glycerol Stock
KIAA1217
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019590.1-1030s1c1
Sequence:CCGGCCTCTAATGGAGAAGCAAGTTCTCGAGAACTTGCTTCTCCATTAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019590.1-541s1c1
Sequence:CCGGGATGAAGACATGAGTGGCAAACTCGAGTTTGCCACTCATGTCTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019590.1-1813s1c1
Sequence:CCGGGCACAGTACATGGCTATGGAACTCGAGTTCCATAGCCATGTACTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019590.1-2551s1c1
Sequence:CCGGGCTAAGGCAAGCAGTGAAGATCTCGAGATCTTCACTGCTTGCCTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019590.1-2869s1c1
Sequence:CCGGGTACGGAAATCTGATGTTGAACTCGAGTTCAACATCAGATTTCCGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019590.1-2146s1c1
Sequence:CCGGCAGAGCTTGTTCATTGAAGAACTCGAGTTCTTCAATGAACAAGCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019590.1-1614s1c1
Sequence:CCGGGAAAGGAGAATTTCCAACCTTCTCGAGAAGGTTGGAAATTCTCCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019590.1-740s1c1
Sequence:CCGGCGGAAATGCATATGGAACAATCTCGAGATTGTTCCATATGCATTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019590.3-4757s21c1
Sequence:CCGGGACATCCGGTCTGCCTATAAGCTCGAGCTTATAGGCAGACCGGATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019590.3-1087s21c1
Sequence:CCGGATCGCCCAGTGTCGCCATTTACTCGAGTAAATGGCGACACTGGGCGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019590.3-1196s21c1
Sequence:CCGGGATCCTGCACATGCGTTTAATCTCGAGATTAAACGCATGTGCAGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019590.3-6329s21c1
Sequence:CCGGTGTATCGTTTGAGGCTTAATGCTCGAGCATTAAGCCTCAAACGATACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019590
KIAA1217 MISSION shRNA shRNA Plasmid DNA
KIAA1217
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019590.1-1030s1c1
Sequence:CCGGCCTCTAATGGAGAAGCAAGTTCTCGAGAACTTGCTTCTCCATTAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019590.1-541s1c1
Sequence:CCGGGATGAAGACATGAGTGGCAAACTCGAGTTTGCCACTCATGTCTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019590.1-1813s1c1
Sequence:CCGGGCACAGTACATGGCTATGGAACTCGAGTTCCATAGCCATGTACTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019590.1-2551s1c1
Sequence:CCGGGCTAAGGCAAGCAGTGAAGATCTCGAGATCTTCACTGCTTGCCTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019590.1-2869s1c1
Sequence:CCGGGTACGGAAATCTGATGTTGAACTCGAGTTCAACATCAGATTTCCGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019590.1-2146s1c1
Sequence:CCGGCAGAGCTTGTTCATTGAAGAACTCGAGTTCTTCAATGAACAAGCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019590.1-1614s1c1
Sequence:CCGGGAAAGGAGAATTTCCAACCTTCTCGAGAAGGTTGGAAATTCTCCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019590.1-740s1c1
Sequence:CCGGCGGAAATGCATATGGAACAATCTCGAGATTGTTCCATATGCATTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000441566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019590.3-4757s21c1
Sequence:CCGGGACATCCGGTCTGCCTATAAGCTCGAGCTTATAGGCAGACCGGATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019590.3-1087s21c1
Sequence:CCGGATCGCCCAGTGTCGCCATTTACTCGAGTAAATGGCGACACTGGGCGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019590.3-1196s21c1
Sequence:CCGGGATCCTGCACATGCGTTTAATCTCGAGATTAAACGCATGTGCAGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019590.3-6329s21c1
Sequence:CCGGTGTATCGTTTGAGGCTTAATGCTCGAGCATTAAGCCTCAAACGATACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019590
KIAA1217 MISSION shRNA Lentiviral Transduction Particles
KIAA1217
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019590.1-1030s1c1
Sequence:CCGGCCTCTAATGGAGAAGCAAGTTCTCGAGAACTTGCTTCTCCATTAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019590.1-541s1c1
Sequence:CCGGGATGAAGACATGAGTGGCAAACTCGAGTTTGCCACTCATGTCTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019590.1-1813s1c1
Sequence:CCGGGCACAGTACATGGCTATGGAACTCGAGTTCCATAGCCATGTACTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019590.1-2551s1c1
Sequence:CCGGGCTAAGGCAAGCAGTGAAGATCTCGAGATCTTCACTGCTTGCCTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019590.1-2869s1c1
Sequence:CCGGGTACGGAAATCTGATGTTGAACTCGAGTTCAACATCAGATTTCCGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019590.1-2146s1c1
Sequence:CCGGCAGAGCTTGTTCATTGAAGAACTCGAGTTCTTCAATGAACAAGCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019590.1-1614s1c1
Sequence:CCGGGAAAGGAGAATTTCCAACCTTCTCGAGAAGGTTGGAAATTCTCCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019590.1-740s1c1
Sequence:CCGGCGGAAATGCATATGGAACAATCTCGAGATTGTTCCATATGCATTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019590.3-4757s21c1
Sequence:CCGGGACATCCGGTCTGCCTATAAGCTCGAGCTTATAGGCAGACCGGATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019590.3-1087s21c1
Sequence:CCGGATCGCCCAGTGTCGCCATTTACTCGAGTAAATGGCGACACTGGGCGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019590.3-1196s21c1
Sequence:CCGGGATCCTGCACATGCGTTTAATCTCGAGATTAAACGCATGTGCAGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019590.3-6329s21c1
Sequence:CCGGTGTATCGTTTGAGGCTTAATGCTCGAGCATTAAGCCTCAAACGATACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)