EMAIL THIS PAGE TO A FRIEND

KIAA1239

KIAA1239

37 Gene Product Result for
UniProtKB ID: Q9ULI1, A8MRU1
Gene ID:
chicken(428789) KIAA1239
cow(539460) KIAA1239 ortholog
domestic cat(101086558) KIAA1239 ortholog
dog(488837) KIAA1239 ortholog
domestic guinea pig(100730366) KIAA1239 ortholog
naked mole-rat(101710921) KIAA1239 ortholog
sheep(101110331) KIAA1239 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001144990 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001144990 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001144990 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001713967 Rosetta Predictions human pricing
XM_049078 Rosetta Predictions human pricing
XM_940885 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001713967 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00394135 predicted 1009
2 SASI_Hs02_00394136 predicted 1279
3 SASI_Hs02_00394137 predicted 1331
4 SASI_Hs02_00394138 predicted 4903
5 SASI_Hs02_00394139 predicted 1404
6 SASI_Hs02_00394140 predicted 3167
7 SASI_Hs02_00394141 predicted 918
8 SASI_Hs02_00394142 predicted 3471
9 SASI_Hs02_00394143 predicted 3902
10 SASI_Hs02_00394144 predicted 1527
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_049078 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00280802 predicted 1010
2 SASI_Hs01_00280805 predicted 1280
3 SASI_Hs02_00478675 predicted 1333
4 SASI_Hs01_00280803 predicted 4905
5 SASI_Hs01_00280804 predicted 1406
6 SASI_Hs01_00280806 predicted 3171
7 SASI_Hs01_00280807 predicted 918
8 SASI_Hs02_00478676 predicted 3474
9 SASI_Hs01_00280808 predicted 3905
10 SASI_Hs01_00280809 predicted 1529
11 SASI_Hs01_00280810 predicted 4065
12 SASI_Hs01_00280811 predicted 4231
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_940885 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00484459 predicted 1013
2 SASI_Hs02_00484460 predicted 1276
3 SASI_Hs02_00484461 predicted 1334
4 SASI_Hs02_00484462 predicted 4909
5 SASI_Hs02_00484463 predicted 1410
6 SASI_Hs02_00484464 predicted 3166
7 SASI_Hs02_00484465 predicted 915
8 SASI_Hs02_00484466 predicted 3478
9 SASI_Hs02_00484467 predicted 3898
10 SASI_Hs02_00484468 predicted 1528
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001144990
KIAA1239 MISSION shRNA Bacterial Glycerol Stock
KIAA1239
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001144990.1-5499s21c1
Sequence:CCGGGTGTGGTGAGGCAGCATAATACTCGAGTATTATGCTGCCTCACCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144990.1-4094s21c1
Sequence:CCGGTAACATCCACCGGAGATATAACTCGAGTTATATCTCCGGTGGATGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144990.1-4469s21c1
Sequence:CCGGGTCCTGATATCATCGTGTTTACTCGAGTAAACACGATGATATCAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144990.1-2267s21c1
Sequence:CCGGACACCATCTTAGCAGATTATTCTCGAGAATAATCTGCTAAGATGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144990.1-847s21c1
Sequence:CCGGGGAACAGAACCGAGGATTATTCTCGAGAATAATCCTCGGTTCTGTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001144990
KIAA1239 MISSION shRNA shRNA Plasmid DNA
KIAA1239
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001144990.1-5499s21c1
Sequence:CCGGGTGTGGTGAGGCAGCATAATACTCGAGTATTATGCTGCCTCACCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144990.1-4094s21c1
Sequence:CCGGTAACATCCACCGGAGATATAACTCGAGTTATATCTCCGGTGGATGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144990.1-4469s21c1
Sequence:CCGGGTCCTGATATCATCGTGTTTACTCGAGTAAACACGATGATATCAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144990.1-2267s21c1
Sequence:CCGGACACCATCTTAGCAGATTATTCTCGAGAATAATCTGCTAAGATGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144990.1-847s21c1
Sequence:CCGGGGAACAGAACCGAGGATTATTCTCGAGAATAATCCTCGGTTCTGTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001144990
KIAA1239 MISSION shRNA Lentiviral Transduction Particles
KIAA1239
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001144990.1-5499s21c1
Sequence:CCGGGTGTGGTGAGGCAGCATAATACTCGAGTATTATGCTGCCTCACCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144990.1-4094s21c1
Sequence:CCGGTAACATCCACCGGAGATATAACTCGAGTTATATCTCCGGTGGATGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144990.1-4469s21c1
Sequence:CCGGGTCCTGATATCATCGTGTTTACTCGAGTAAACACGATGATATCAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144990.1-2267s21c1
Sequence:CCGGACACCATCTTAGCAGATTATTCTCGAGAATAATCTGCTAAGATGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144990.1-847s21c1
Sequence:CCGGGGAACAGAACCGAGGATTATTCTCGAGAATAATCCTCGGTTCTGTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)