EMAIL THIS PAGE TO A FRIEND

KIAA1257

KIAA1257

36 Gene Product Result for
UniProtKB ID: Q9ULG3, Q8IXY7, Q8N5T4
Gene ID:
cow(785686) KIAA1257 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020741 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020741 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020741 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU014161 MISSION® esiRNA esiRNA targeting human KIAA1257 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020741 Rosetta Predictions human pricing
XM_371664 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020741 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353839 predicted 1174
2 SASI_Hs02_00353840 predicted 1153
3 SASI_Hs02_00353841 predicted 1130
4 SASI_Hs02_00353842 predicted 794
5 SASI_Hs02_00353843 predicted 915
6 SASI_Hs02_00353844 predicted 982
7 SASI_Hs02_00353845 predicted 619
8 SASI_Hs02_00353846 predicted 1096
9 SASI_Hs02_00353847 predicted 590
10 SASI_Hs02_00353848 predicted 1021
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371664 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00289297 predicted 1103
2 SASI_Hs01_00289298 predicted 750
3 SASI_Hs01_00289299 predicted 837
4 SASI_Hs01_00289300 predicted 952
5 SASI_Hs01_00289301 predicted 802
6 SASI_Hs01_00289302 predicted 1025
7 SASI_Hs01_00289303 predicted 863
8 SASI_Hs01_00289304 predicted 1057
9 SASI_Hs01_00289305 predicted 1127
10 SASI_Hs01_00289306 predicted 1062
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020741
KIAA1257 MISSION shRNA Bacterial Glycerol Stock
KIAA1257
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000268596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020741.1-712s21c1
Sequence:CCGGCACTGTGACAAAGGAATTATTCTCGAGAATAATTCCTTTGTCACAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020741.1-1548s21c1
Sequence:CCGGCTACCTTGCCTGAGATCACACCTCGAGGTGTGATCTCAGGCAAGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020741.1-1075s21c1
Sequence:CCGGCGATTCTTCCACGATTCAATGCTCGAGCATTGAATCGTGGAAGAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020741.1-799s21c1
Sequence:CCGGAGTCAGATATTACCGATTAAACTCGAGTTTAATCGGTAATATCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020741.1-909s21c1
Sequence:CCGGGCATTGAGAATACCAACATTGCTCGAGCAATGTTGGTATTCTCAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020741
KIAA1257 MISSION shRNA shRNA Plasmid DNA
KIAA1257
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000268596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020741.1-712s21c1
Sequence:CCGGCACTGTGACAAAGGAATTATTCTCGAGAATAATTCCTTTGTCACAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020741.1-1548s21c1
Sequence:CCGGCTACCTTGCCTGAGATCACACCTCGAGGTGTGATCTCAGGCAAGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020741.1-1075s21c1
Sequence:CCGGCGATTCTTCCACGATTCAATGCTCGAGCATTGAATCGTGGAAGAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020741.1-799s21c1
Sequence:CCGGAGTCAGATATTACCGATTAAACTCGAGTTTAATCGGTAATATCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020741.1-909s21c1
Sequence:CCGGGCATTGAGAATACCAACATTGCTCGAGCAATGTTGGTATTCTCAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020741
KIAA1257 MISSION shRNA Lentiviral Transduction Particles
KIAA1257
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000268596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020741.1-712s21c1
Sequence:CCGGCACTGTGACAAAGGAATTATTCTCGAGAATAATTCCTTTGTCACAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020741.1-1548s21c1
Sequence:CCGGCTACCTTGCCTGAGATCACACCTCGAGGTGTGATCTCAGGCAAGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020741.1-1075s21c1
Sequence:CCGGCGATTCTTCCACGATTCAATGCTCGAGCATTGAATCGTGGAAGAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020741.1-799s21c1
Sequence:CCGGAGTCAGATATTACCGATTAAACTCGAGTTTAATCGGTAATATCTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020741.1-909s21c1
Sequence:CCGGGCATTGAGAATACCAACATTGCTCGAGCAATGTTGGTATTCTCAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)