EMAIL THIS PAGE TO A FRIEND

KIAA1279

KIAA1279

23 Gene Product Result for
Synonyms: KBP TTC20
UniProtKB ID: Q96EK5, A8K5M8, Q9BR89, Q9ULE1, Q9Y428
Gene ID:
Human(26128) Summary: This gene encodes a kinesin family member 1 binding protein that is characterized by two tetratrico peptide repeats. The encoded protein localizes to the mitochondria and may be involved in regulating transport of the mitochondria. Mutations in this gene are associated with Goldberg-Shprintzen megacolon syndrome. [provided by RefSeq, Mar 2010]
chicken(423694) KIAA1279
dog(479232) KIAA1279 ortholog
domestic cat(101092892) KIAA1279 ortholog
cow(527433) KIAA1279 ortholog
domestic guinea pig(100720078) KIAA1279 ortholog
naked mole-rat(101705511) KIAA1279 ortholog
sheep(101107066) KIAA1279 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015634 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015634 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015634 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU126031 MISSION® esiRNA esiRNA human KIAA1279 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015634 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015634 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156357 predicted 1885
2 SASI_Hs01_00156359 predicted 1275
3 SASI_Hs01_00156360 predicted 1378
4 SASI_Hs01_00156361 predicted 827
5 SASI_Hs01_00156362 predicted 2025
6 SASI_Hs01_00156363 predicted 1318
7 SASI_Hs01_00156364 predicted 1085
8 SASI_Hs01_00156365 predicted 581
9 SASI_Hs01_00156366 predicted 1859
10 SASI_Hs02_00348231 predicted 1295
11 SASI_Hs01_00156358 predicted 849
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015634
VALIDATED
KIAA1279 MISSION shRNA Bacterial Glycerol Stock
KIAA1279
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015634.2-1025s21c1
Sequence:CCGGTAGCAAGGTGCTGGATCAAATCTCGAGATTTGATCCAGCACCTTGCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015634.2-186s21c1
Sequence:CCGGGGAACCATACAAGTCCAAATACTCGAGTATTTGGACTTGTATGGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015634.2-1421s21c1
Sequence:CCGGGACGGTGCAAGATGCATAAACCTCGAGGTTTATGCATCTTGCACCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015634.1-1632s1c1
Sequence:CCGGCCCTGCCATGTTAGCTAAGTTCTCGAGAACTTAGCTAACATGGCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015634.1-1209s1c1
Sequence:CCGGGCACTATGTCTTTGAGGCAAACTCGAGTTTGCCTCAAAGACATAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015634.1-487s1c1
Sequence:CCGGGCTTACCTAGAGTCATCAGAACTCGAGTTCTGATGACTCTAGGTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165291    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015634.1-2204s1c1
Sequence:CCGGGCTGGGTAATGTACCTGGTAACTCGAGTTACCAGGTACATTACCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015634.1-729s1c1
Sequence:CCGGGCACAATGCCTACCATCCTATCTCGAGATAGGATGGTAGGCATTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015634.1-96s1c1
Sequence:CCGGGAAGGAACCATACAAGTCCAACTCGAGTTGGACTTGTATGGTTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159114    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015634.1-1447s1c1
Sequence:CCGGGCTTACTATGATATGATGGATCTCGAGATCCATCATATCATAGTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015634
VALIDATED
KIAA1279 MISSION shRNA shRNA Plasmid DNA
KIAA1279
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015634.2-1025s21c1
Sequence:CCGGTAGCAAGGTGCTGGATCAAATCTCGAGATTTGATCCAGCACCTTGCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015634.2-186s21c1
Sequence:CCGGGGAACCATACAAGTCCAAATACTCGAGTATTTGGACTTGTATGGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015634.2-1421s21c1
Sequence:CCGGGACGGTGCAAGATGCATAAACCTCGAGGTTTATGCATCTTGCACCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015634.1-1632s1c1
Sequence:CCGGCCCTGCCATGTTAGCTAAGTTCTCGAGAACTTAGCTAACATGGCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015634.1-1209s1c1
Sequence:CCGGGCACTATGTCTTTGAGGCAAACTCGAGTTTGCCTCAAAGACATAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015634.1-487s1c1
Sequence:CCGGGCTTACCTAGAGTCATCAGAACTCGAGTTCTGATGACTCTAGGTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165291    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015634.1-2204s1c1
Sequence:CCGGGCTGGGTAATGTACCTGGTAACTCGAGTTACCAGGTACATTACCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015634.1-729s1c1
Sequence:CCGGGCACAATGCCTACCATCCTATCTCGAGATAGGATGGTAGGCATTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015634.1-96s1c1
Sequence:CCGGGAAGGAACCATACAAGTCCAACTCGAGTTGGACTTGTATGGTTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159114    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015634.1-1447s1c1
Sequence:CCGGGCTTACTATGATATGATGGATCTCGAGATCCATCATATCATAGTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015634
VALIDATED
KIAA1279 MISSION shRNA Lentiviral Transduction Particles
KIAA1279
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015634.2-1025s21c1
Sequence:CCGGTAGCAAGGTGCTGGATCAAATCTCGAGATTTGATCCAGCACCTTGCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015634.2-186s21c1
Sequence:CCGGGGAACCATACAAGTCCAAATACTCGAGTATTTGGACTTGTATGGTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015634.2-1421s21c1
Sequence:CCGGGACGGTGCAAGATGCATAAACCTCGAGGTTTATGCATCTTGCACCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015634.1-1632s1c1
Sequence:CCGGCCCTGCCATGTTAGCTAAGTTCTCGAGAACTTAGCTAACATGGCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015634.1-1209s1c1
Sequence:CCGGGCACTATGTCTTTGAGGCAAACTCGAGTTTGCCTCAAAGACATAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015634.1-487s1c1
Sequence:CCGGGCTTACCTAGAGTCATCAGAACTCGAGTTCTGATGACTCTAGGTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165291    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015634.1-2204s1c1
Sequence:CCGGGCTGGGTAATGTACCTGGTAACTCGAGTTACCAGGTACATTACCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015634.1-729s1c1
Sequence:CCGGGCACAATGCCTACCATCCTATCTCGAGATAGGATGGTAGGCATTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015634.1-96s1c1
Sequence:CCGGGAAGGAACCATACAAGTCCAACTCGAGTTGGACTTGTATGGTTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159114    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015634.1-1447s1c1
Sequence:CCGGGCTTACTATGATATGATGGATCTCGAGATCCATCATATCATAGTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)