EMAIL THIS PAGE TO A FRIEND

KIAA1324

KIAA1324

71 Gene Product Result for
Synonyms: EIG121
UniProtKB ID: Q6UXG2, Q08AE6, Q5T5C9, Q5T5D0, Q5T5D1, Q9P2M2
Gene ID:
Human(57535) Summary: Expression of this gene is induced by estrogen and the encoded protein has been characterized as a transmembrane protein. The encoded protein has been found in to correlate with survival in certain carcinomas (PMID: 21102415) and may be important for cellular response to stress (PMID: 21072319). Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2012]
chicken(429496) KIAA1324
cow(784449) KIAA1324 ortholog
domestic cat(101097574) KIAA1324 ortholog
dog(479917) KIAA1324 ortholog
sheep(101103105) KIAA1324 ortholog
domestic guinea pig(100729037) KIAA1324 ortholog
naked mole-rat(101724216) KIAA1324 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020775 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020775 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020775 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU031111 MISSION® esiRNA esiRNA human KIAA1324 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020775 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020775 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061111 predicted 1952
2 SASI_Hs01_00061112 predicted 957
3 SASI_Hs01_00061113 predicted 1737
4 SASI_Hs01_00061114 predicted 830
5 SASI_Hs01_00061115 predicted 2095
6 SASI_Hs01_00061117 predicted 700
7 SASI_Hs01_00061118 predicted 1182
8 SASI_Hs02_00353914 predicted 1038
9 SASI_Hs01_00061119 predicted 2240
10 SASI_Hs02_00353915 predicted 2506
11 SASI_Hs01_00061110 predicted 1083
12 SASI_Hs01_00061116 predicted 652
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020775
KIAA1324 MISSION shRNA Bacterial Glycerol Stock
KIAA1324
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020775.2-2756s21c1
Sequence:CCGGGGGATCCAGAAGACTACTTACCTCGAGGTAAGTAGTCTTCTGGATCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172276    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020775.2-3209s1c1
Sequence:CCGGCCTTGCATAGCACCTTTGCAACTCGAGTTGCAAAGGTGCTATGCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020775.2-3073s1c1
Sequence:CCGGGTCACTCTTTGGGAAGATCAACTCGAGTTGATCTTCCCAAAGAGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263309    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020775.2-3223s21c1
Sequence:CCGGTTTGCAAGCCTGCGGCGATTTCTCGAGAAATCGCCGCAGGCTTGCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020775.2-1740s21c1
Sequence:CCGGAGTCCTATACCTACATCATTGCTCGAGCAATGATGTAGGTATAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020775.2-845s1c1
Sequence:CCGGCGAGGCAATAATGTCCTCTATCTCGAGATAGAGGACATTATTGCCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020775.2-1947s21c1
Sequence:CCGGCTTGTCCTGCTGGTTACTATACTCGAGTATAGTAACCAGCAGGACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020775.2-2416s21c1
Sequence:CCGGCAGCCTTGCTGATCGACTTATCTCGAGATAAGTCGATCAGCAAGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020775
KIAA1324 MISSION shRNA shRNA Plasmid DNA
KIAA1324
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020775.2-2756s21c1
Sequence:CCGGGGGATCCAGAAGACTACTTACCTCGAGGTAAGTAGTCTTCTGGATCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172276    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020775.2-3209s1c1
Sequence:CCGGCCTTGCATAGCACCTTTGCAACTCGAGTTGCAAAGGTGCTATGCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020775.2-3073s1c1
Sequence:CCGGGTCACTCTTTGGGAAGATCAACTCGAGTTGATCTTCCCAAAGAGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263309    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020775.2-3223s21c1
Sequence:CCGGTTTGCAAGCCTGCGGCGATTTCTCGAGAAATCGCCGCAGGCTTGCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020775.2-1740s21c1
Sequence:CCGGAGTCCTATACCTACATCATTGCTCGAGCAATGATGTAGGTATAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020775.2-845s1c1
Sequence:CCGGCGAGGCAATAATGTCCTCTATCTCGAGATAGAGGACATTATTGCCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020775.2-1947s21c1
Sequence:CCGGCTTGTCCTGCTGGTTACTATACTCGAGTATAGTAACCAGCAGGACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020775.2-2416s21c1
Sequence:CCGGCAGCCTTGCTGATCGACTTATCTCGAGATAAGTCGATCAGCAAGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020775
KIAA1324 MISSION shRNA Lentiviral Transduction Particles
KIAA1324
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020775.2-2756s21c1
Sequence:CCGGGGGATCCAGAAGACTACTTACCTCGAGGTAAGTAGTCTTCTGGATCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172276    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020775.2-3209s1c1
Sequence:CCGGCCTTGCATAGCACCTTTGCAACTCGAGTTGCAAAGGTGCTATGCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020775.2-3073s1c1
Sequence:CCGGGTCACTCTTTGGGAAGATCAACTCGAGTTGATCTTCCCAAAGAGTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263309    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020775.2-3223s21c1
Sequence:CCGGTTTGCAAGCCTGCGGCGATTTCTCGAGAAATCGCCGCAGGCTTGCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020775.2-1740s21c1
Sequence:CCGGAGTCCTATACCTACATCATTGCTCGAGCAATGATGTAGGTATAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020775.2-845s1c1
Sequence:CCGGCGAGGCAATAATGTCCTCTATCTCGAGATAGAGGACATTATTGCCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020775.2-1947s21c1
Sequence:CCGGCTTGTCCTGCTGGTTACTATACTCGAGTATAGTAACCAGCAGGACAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020775.2-2416s21c1
Sequence:CCGGCAGCCTTGCTGATCGACTTATCTCGAGATAAGTCGATCAGCAAGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)