EMAIL THIS PAGE TO A FRIEND

KIAA1328

KIAA1328

109 Gene Product Result for
UniProtKB ID: Q86T90, Q05DL0, Q49AG6, Q9P2L8
Gene ID:
chicken(426890) KIAA1328
dog(480155) KIAA1328 ortholog
cow(785328) KIAA1328 ortholog
domestic cat(101096113) KIAA1328 ortholog
sheep(101115087) KIAA1328 ortholog
domestic guinea pig(100732314) KIAA1328 ortholog
naked mole-rat(101717004) KIAA1328 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA040946 Anti-KIAA1328 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020776 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020776 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020776 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU056631 MISSION® esiRNA esiRNA human KIAA1328 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020776 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020776 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157041 predicted 719
2 SASI_Hs01_00157042 predicted 733
3 SASI_Hs01_00157043 predicted 560
4 SASI_Hs01_00157045 predicted 673
5 SASI_Hs01_00157047 predicted 814
6 SASI_Hs01_00157049 predicted 802
7 SASI_Hs01_00157050 predicted 695
8 SASI_Hs02_00353916 predicted 881
9 SASI_Hs02_00353917 predicted 739
10 SASI_Hs02_00353918 predicted 1015
11 SASI_Hs01_00157044 predicted 1553
12 SASI_Hs01_00157046 predicted 516
13 SASI_Hs01_00157048 predicted 782
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020776
KIAA1328 MISSION shRNA Bacterial Glycerol Stock
KIAA1328
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173021    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020776.1-2029s1c1
Sequence:CCGGCGTGGTGGAAACCATTGCATACTCGAGTATGCAATGGTTTCCACCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020776.1-1870s21c1
Sequence:CCGGACTAGCATCCTGTTACGTATTCTCGAGAATACGTAACAGGATGCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020776.1-916s21c1
Sequence:CCGGTAAGCCTACTCCTAGTCAATGCTCGAGCATTGACTAGGAGTAGGCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020776.1-1360s21c1
Sequence:CCGGAGTTGGGTTTCATTCGCATATCTCGAGATATGCGAATGAAACCCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020776.1-1289s21c1
Sequence:CCGGGGAACATCATCATCTATTAAACTCGAGTTTAATAGATGATGATGTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020776.1-729s21c1
Sequence:CCGGCAGAATCCCTTATAGCATTTACTCGAGTAAATGCTATAAGGGATTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020776
KIAA1328 MISSION shRNA shRNA Plasmid DNA
KIAA1328
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173021    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020776.1-2029s1c1
Sequence:CCGGCGTGGTGGAAACCATTGCATACTCGAGTATGCAATGGTTTCCACCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020776.1-1870s21c1
Sequence:CCGGACTAGCATCCTGTTACGTATTCTCGAGAATACGTAACAGGATGCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020776.1-916s21c1
Sequence:CCGGTAAGCCTACTCCTAGTCAATGCTCGAGCATTGACTAGGAGTAGGCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020776.1-1360s21c1
Sequence:CCGGAGTTGGGTTTCATTCGCATATCTCGAGATATGCGAATGAAACCCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020776.1-1289s21c1
Sequence:CCGGGGAACATCATCATCTATTAAACTCGAGTTTAATAGATGATGATGTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020776.1-729s21c1
Sequence:CCGGCAGAATCCCTTATAGCATTTACTCGAGTAAATGCTATAAGGGATTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020776
KIAA1328 MISSION shRNA Lentiviral Transduction Particles
KIAA1328
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173021    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020776.1-2029s1c1
Sequence:CCGGCGTGGTGGAAACCATTGCATACTCGAGTATGCAATGGTTTCCACCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020776.1-1870s21c1
Sequence:CCGGACTAGCATCCTGTTACGTATTCTCGAGAATACGTAACAGGATGCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020776.1-916s21c1
Sequence:CCGGTAAGCCTACTCCTAGTCAATGCTCGAGCATTGACTAGGAGTAGGCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020776.1-1360s21c1
Sequence:CCGGAGTTGGGTTTCATTCGCATATCTCGAGATATGCGAATGAAACCCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020776.1-1289s21c1
Sequence:CCGGGGAACATCATCATCTATTAAACTCGAGTTTAATAGATGATGATGTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020776.1-729s21c1
Sequence:CCGGCAGAATCCCTTATAGCATTTACTCGAGTAAATGCTATAAGGGATTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)