EMAIL THIS PAGE TO A FRIEND

KIAA1377

KIAA1377

20 Gene Product Result for
UniProtKB ID: Q9P2H0, Q4G0U6
Gene ID:
chicken(100859489) KIAA1377 ortholog
cow(787564) KIAA1377 ortholog
domestic cat(101082938) KIAA1377 ortholog
dog(489434) KIAA1377 ortholog
domestic guinea pig(100726303) KIAA1377 ortholog
naked mole-rat(101720895) KIAA1377 ortholog
sheep(101122133) KIAA1377 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020802 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020802 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020802 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU042231 MISSION® esiRNA esiRNA human KIAA1377 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020802 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020802 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159484 predicted 927
2 SASI_Hs01_00159485 predicted 3048
3 SASI_Hs02_00353976 predicted 1009
4 SASI_Hs01_00159486 predicted 464
5 SASI_Hs02_00353977 predicted 2989
6 SASI_Hs01_00159487 predicted 1129
7 SASI_Hs01_00159489 predicted 2085
8 SASI_Hs01_00159490 predicted 2556
9 SASI_Hs01_00159491 predicted 1838
10 SASI_Hs02_00353978 predicted 2019
11 SASI_Hs01_00159483 predicted 3503
12 SASI_Hs01_00159488 predicted 2153
13 SASI_Hs01_00159492 predicted 3477
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020802
KIAA1377 MISSION shRNA Bacterial Glycerol Stock
KIAA1377
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020802.1-2983s1c1
Sequence:CCGGGCACCCAAAGAAGTCCTGTTTCTCGAGAAACAGGACTTCTTTGGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020802.1-1339s1c1
Sequence:CCGGGAGCCACAAATACTGCTAATACTCGAGTATTAGCAGTATTTGTGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020802.1-2471s1c1
Sequence:CCGGCCCTGTACATGATGATTCTAACTCGAGTTAGAATCATCATGTACAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020802.1-2237s1c1
Sequence:CCGGGCATTCTCAACAATTCCACATCTCGAGATGTGGAATTGTTGAGAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020802.1-2971s1c1
Sequence:CCGGCGACATTATATTGCACCCAAACTCGAGTTTGGGTGCAATATAATGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020802.1-4124s1c1
Sequence:CCGGGCAGCAATAGAGCAAAGGTTACTCGAGTAACCTTTGCTCTATTGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020802
KIAA1377 MISSION shRNA shRNA Plasmid DNA
KIAA1377
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020802.1-2983s1c1
Sequence:CCGGGCACCCAAAGAAGTCCTGTTTCTCGAGAAACAGGACTTCTTTGGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020802.1-1339s1c1
Sequence:CCGGGAGCCACAAATACTGCTAATACTCGAGTATTAGCAGTATTTGTGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020802.1-2471s1c1
Sequence:CCGGCCCTGTACATGATGATTCTAACTCGAGTTAGAATCATCATGTACAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020802.1-2237s1c1
Sequence:CCGGGCATTCTCAACAATTCCACATCTCGAGATGTGGAATTGTTGAGAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020802.1-2971s1c1
Sequence:CCGGCGACATTATATTGCACCCAAACTCGAGTTTGGGTGCAATATAATGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020802.1-4124s1c1
Sequence:CCGGGCAGCAATAGAGCAAAGGTTACTCGAGTAACCTTTGCTCTATTGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020802
KIAA1377 MISSION shRNA Lentiviral Transduction Particles
KIAA1377
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020802.1-2983s1c1
Sequence:CCGGGCACCCAAAGAAGTCCTGTTTCTCGAGAAACAGGACTTCTTTGGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020802.1-1339s1c1
Sequence:CCGGGAGCCACAAATACTGCTAATACTCGAGTATTAGCAGTATTTGTGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020802.1-2471s1c1
Sequence:CCGGCCCTGTACATGATGATTCTAACTCGAGTTAGAATCATCATGTACAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020802.1-2237s1c1
Sequence:CCGGGCATTCTCAACAATTCCACATCTCGAGATGTGGAATTGTTGAGAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020802.1-2971s1c1
Sequence:CCGGCGACATTATATTGCACCCAAACTCGAGTTTGGGTGCAATATAATGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020802.1-4124s1c1
Sequence:CCGGGCAGCAATAGAGCAAAGGTTACTCGAGTAACCTTTGCTCTATTGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)