EMAIL THIS PAGE TO A FRIEND

KIAA1407

KIAA1407

23 Gene Product Result for
UniProtKB ID: Q8NCU4, Q9P2E0
Gene ID:
chicken(418352) KIAA1407
dog(487982) KIAA1407 ortholog
cow(532832) KIAA1407 ortholog
domestic cat(101097831) KIAA1407 ortholog
sheep(101116278) KIAA1407 ortholog
domestic guinea pig(100715512) KIAA1407 ortholog
naked mole-rat(101715127) KIAA1407 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020817 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020817 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020817 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU063641 MISSION® esiRNA esiRNA human KIAA1407 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020817 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020817 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034409 predicted 3032
2 SASI_Hs02_00354018 predicted 1143
3 SASI_Hs02_00354019 predicted 936
4 SASI_Hs02_00354020 predicted 970
5 SASI_Hs01_00034413 predicted 3046
6 SASI_Hs01_00034414 predicted 2959
7 SASI_Hs02_00354021 predicted 1230
8 SASI_Hs01_00034415 predicted 545
9 SASI_Hs01_00034416 predicted 2672
10 SASI_Hs01_00034417 predicted 422
11 SASI_Hs01_00034410 predicted 1510
12 SASI_Hs01_00034411 predicted 818
13 SASI_Hs01_00034412 predicted 713
14 SASI_Hs01_00034418 predicted 435
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020817
VALIDATED
KIAA1407 MISSION shRNA Bacterial Glycerol Stock
KIAA1407
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020817.1-2842s1c1
Sequence:CCGGCTTCGTAGGAAGGTAGTTGAACTCGAGTTCAACTACCTTCCTACGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020817.1-724s1c1
Sequence:CCGGGAGATGAGACATAAGCAGGTACTCGAGTACCTGCTTATGTCTCATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020817.1-1745s1c1
Sequence:CCGGGCAACGAGACACTCAGAACTACTCGAGTAGTTCTGAGTGTCTCGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141049    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020817.1-3634s1c1
Sequence:CCGGCCACCTGCAACTGCTGAATAACTCGAGTTATTCAGCAGTTGCAGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020817.1-424s1c1
Sequence:CCGGGAGCTGGTCAATGACTGGTTACTCGAGTAACCAGTCATTGACCAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020817.1-2519s1c1
Sequence:CCGGGTCAGGAAAGTCTGGCTAGAACTCGAGTTCTAGCCAGACTTTCCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020817.1-2380s1c1
Sequence:CCGGGAAAGGGTCTTGCTAAGGAAACTCGAGTTTCCTTAGCAAGACCCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020817.1-2931s1c1
Sequence:CCGGGAGTAAGACAAGTCTGGTGAACTCGAGTTCACCAGACTTGTCTTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020817.1-2845s1c1
Sequence:CCGGCGTAGGAAGGTAGTTGAAATTCTCGAGAATTTCAACTACCTTCCTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121684    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020817.1-3646s1c1
Sequence:CCGGGCTGAATAATACACTCAGTTTCTCGAGAAACTGAGTGTATTATTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145585    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020817.1-3062s1c1
Sequence:CCGGCGAGCTACTTCTTAGATCAAACTCGAGTTTGATCTAAGAAGTAGCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145061    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020817.1-3170s1c1
Sequence:CCGGCCAAAGGAACATTCTAGAGATCTCGAGATCTCTAGAATGTTCCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020817.1-2597s21c1
Sequence:CCGGGCTGGCTACAGTACGTGATTGCTCGAGCAATCACGTACTGTAGCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020817.1-752s21c1
Sequence:CCGGATCGCTTAAGACGTGAGAAAGCTCGAGCTTTCTCACGTCTTAAGCGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429865    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020817.1-3300s21c1
Sequence:CCGGGTTGCTGATGTGACCTTAATGCTCGAGCATTAAGGTCACATCAGCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020817.1-3128s21c1
Sequence:CCGGATTGCTAGTCATTCACTATAGCTCGAGCTATAGTGAATGACTAGCAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020817.1-1156s21c1
Sequence:CCGGATTCTTGATCATAGGATTAAGCTCGAGCTTAATCCTATGATCAAGAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020817.1-911s21c1
Sequence:CCGGAGCTGCGGAGGGAGATAATTGCTCGAGCAATTATCTCCCTCCGCAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020817
VALIDATED
KIAA1407 MISSION shRNA shRNA Plasmid DNA
KIAA1407
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020817.1-2842s1c1
Sequence:CCGGCTTCGTAGGAAGGTAGTTGAACTCGAGTTCAACTACCTTCCTACGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020817.1-724s1c1
Sequence:CCGGGAGATGAGACATAAGCAGGTACTCGAGTACCTGCTTATGTCTCATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020817.1-1745s1c1
Sequence:CCGGGCAACGAGACACTCAGAACTACTCGAGTAGTTCTGAGTGTCTCGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141049    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020817.1-3634s1c1
Sequence:CCGGCCACCTGCAACTGCTGAATAACTCGAGTTATTCAGCAGTTGCAGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020817.1-424s1c1
Sequence:CCGGGAGCTGGTCAATGACTGGTTACTCGAGTAACCAGTCATTGACCAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020817.1-2519s1c1
Sequence:CCGGGTCAGGAAAGTCTGGCTAGAACTCGAGTTCTAGCCAGACTTTCCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020817.1-2380s1c1
Sequence:CCGGGAAAGGGTCTTGCTAAGGAAACTCGAGTTTCCTTAGCAAGACCCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020817.1-2931s1c1
Sequence:CCGGGAGTAAGACAAGTCTGGTGAACTCGAGTTCACCAGACTTGTCTTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020817.1-2845s1c1
Sequence:CCGGCGTAGGAAGGTAGTTGAAATTCTCGAGAATTTCAACTACCTTCCTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121684    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020817.1-3646s1c1
Sequence:CCGGGCTGAATAATACACTCAGTTTCTCGAGAAACTGAGTGTATTATTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145585    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020817.1-3062s1c1
Sequence:CCGGCGAGCTACTTCTTAGATCAAACTCGAGTTTGATCTAAGAAGTAGCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145061    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020817.1-3170s1c1
Sequence:CCGGCCAAAGGAACATTCTAGAGATCTCGAGATCTCTAGAATGTTCCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000444531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020817.1-2597s21c1
Sequence:CCGGGCTGGCTACAGTACGTGATTGCTCGAGCAATCACGTACTGTAGCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020817.1-752s21c1
Sequence:CCGGATCGCTTAAGACGTGAGAAAGCTCGAGCTTTCTCACGTCTTAAGCGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429865    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020817.1-3300s21c1
Sequence:CCGGGTTGCTGATGTGACCTTAATGCTCGAGCATTAAGGTCACATCAGCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020817.1-3128s21c1
Sequence:CCGGATTGCTAGTCATTCACTATAGCTCGAGCTATAGTGAATGACTAGCAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020817.1-1156s21c1
Sequence:CCGGATTCTTGATCATAGGATTAAGCTCGAGCTTAATCCTATGATCAAGAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020817.1-911s21c1
Sequence:CCGGAGCTGCGGAGGGAGATAATTGCTCGAGCAATTATCTCCCTCCGCAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020817
VALIDATED
KIAA1407 MISSION shRNA Lentiviral Transduction Particles
KIAA1407
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020817.1-2842s1c1
Sequence:CCGGCTTCGTAGGAAGGTAGTTGAACTCGAGTTCAACTACCTTCCTACGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020817.1-724s1c1
Sequence:CCGGGAGATGAGACATAAGCAGGTACTCGAGTACCTGCTTATGTCTCATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020817.1-1745s1c1
Sequence:CCGGGCAACGAGACACTCAGAACTACTCGAGTAGTTCTGAGTGTCTCGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141049    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020817.1-3634s1c1
Sequence:CCGGCCACCTGCAACTGCTGAATAACTCGAGTTATTCAGCAGTTGCAGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020817.1-424s1c1
Sequence:CCGGGAGCTGGTCAATGACTGGTTACTCGAGTAACCAGTCATTGACCAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020817.1-2519s1c1
Sequence:CCGGGTCAGGAAAGTCTGGCTAGAACTCGAGTTCTAGCCAGACTTTCCTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020817.1-2380s1c1
Sequence:CCGGGAAAGGGTCTTGCTAAGGAAACTCGAGTTTCCTTAGCAAGACCCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020817.1-2931s1c1
Sequence:CCGGGAGTAAGACAAGTCTGGTGAACTCGAGTTCACCAGACTTGTCTTACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020817.1-2845s1c1
Sequence:CCGGCGTAGGAAGGTAGTTGAAATTCTCGAGAATTTCAACTACCTTCCTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121684    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020817.1-3646s1c1
Sequence:CCGGGCTGAATAATACACTCAGTTTCTCGAGAAACTGAGTGTATTATTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145585    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020817.1-3062s1c1
Sequence:CCGGCGAGCTACTTCTTAGATCAAACTCGAGTTTGATCTAAGAAGTAGCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145061    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020817.1-3170s1c1
Sequence:CCGGCCAAAGGAACATTCTAGAGATCTCGAGATCTCTAGAATGTTCCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020817.1-2597s21c1
Sequence:CCGGGCTGGCTACAGTACGTGATTGCTCGAGCAATCACGTACTGTAGCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020817.1-752s21c1
Sequence:CCGGATCGCTTAAGACGTGAGAAAGCTCGAGCTTTCTCACGTCTTAAGCGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429865    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020817.1-3300s21c1
Sequence:CCGGGTTGCTGATGTGACCTTAATGCTCGAGCATTAAGGTCACATCAGCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020817.1-3128s21c1
Sequence:CCGGATTGCTAGTCATTCACTATAGCTCGAGCTATAGTGAATGACTAGCAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020817.1-1156s21c1
Sequence:CCGGATTCTTGATCATAGGATTAAGCTCGAGCTTAATCCTATGATCAAGAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020817.1-911s21c1
Sequence:CCGGAGCTGCGGAGGGAGATAATTGCTCGAGCAATTATCTCCCTCCGCAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)