EMAIL THIS PAGE TO A FRIEND

KIAA1430

KIAA1430

84 Gene Product Result for
Gene ID:
chicken(422545) KIAA1430
dog(100685778) KIAA1430 ortholog
cow(508280) KIAA1430 ortholog
domestic cat(101091361) KIAA1430 ortholog
chicken(769110) KIAA1430 ortholog
sheep(101111772) KIAA1430 ortholog
domestic guinea pig(100728047) KIAA1430 ortholog
naked mole-rat(101707114) KIAA1430 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020827 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020827 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020827 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020827 Rosetta Predictions human pricing
XM_927144 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020827 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354056 predicted 1803
2 SASI_Hs02_00354057 predicted 906
3 SASI_Hs02_00354058 predicted 1125
4 SASI_Hs02_00354059 predicted 396
5 SASI_Hs02_00354060 predicted 931
6 SASI_Hs02_00354061 predicted 1513
7 SASI_Hs02_00354062 predicted 1552
8 SASI_Hs02_00354063 predicted 393
9 SASI_Hs02_00354064 predicted 1425
10 SASI_Hs02_00354065 predicted 1096
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927144 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00250346 predicted 1101
2 SASI_Hs01_00250347 predicted 1130
3 SASI_Hs01_00250348 predicted 1083
4 SASI_Hs01_00250349 predicted 1135
5 SASI_Hs01_00250350 predicted 1067
6 SASI_Hs01_00250351 predicted 1126
7 SASI_Hs01_00250352 predicted 1143
8 SASI_Hs01_00250353 predicted 1211
9 SASI_Hs01_00250354 predicted 1152
10 SASI_Hs01_00250355 predicted 1090
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020827
VALIDATED
KIAA1430 MISSION shRNA Bacterial Glycerol Stock
KIAA1430
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000268677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020827.1-1531s21c1
Sequence:CCGGATGGACTATCATCGCAATATGCTCGAGCATATTGCGATGATAGTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020827.1-1590s21c1
Sequence:CCGGATCCACTCTTGGCCAATATAGCTCGAGCTATATTGGCCAAGAGTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268680    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_020827.1-1795s21c1
Sequence:CCGGTCGTGCATATTCCTATAATTCCTCGAGGAATTATAGGAATATGCACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_020827.1-1726s21c1
Sequence:CCGGGTCCGTACAGCTTGGTTATAACTCGAGTTATAACCAAGCTGTACGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020827.1-598s21c1
Sequence:CCGGTCCGCTAAACCATCTACTAACCTCGAGGTTAGTAGATGGTTTAGCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020827
VALIDATED
KIAA1430 MISSION shRNA shRNA Plasmid DNA
KIAA1430
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000268677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020827.1-1531s21c1
Sequence:CCGGATGGACTATCATCGCAATATGCTCGAGCATATTGCGATGATAGTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020827.1-1590s21c1
Sequence:CCGGATCCACTCTTGGCCAATATAGCTCGAGCTATATTGGCCAAGAGTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268680    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_020827.1-1795s21c1
Sequence:CCGGTCGTGCATATTCCTATAATTCCTCGAGGAATTATAGGAATATGCACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_020827.1-1726s21c1
Sequence:CCGGGTCCGTACAGCTTGGTTATAACTCGAGTTATAACCAAGCTGTACGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020827.1-598s21c1
Sequence:CCGGTCCGCTAAACCATCTACTAACCTCGAGGTTAGTAGATGGTTTAGCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020827
VALIDATED
KIAA1430 MISSION shRNA Lentiviral Transduction Particles
KIAA1430
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000268677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020827.1-1531s21c1
Sequence:CCGGATGGACTATCATCGCAATATGCTCGAGCATATTGCGATGATAGTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020827.1-1590s21c1
Sequence:CCGGATCCACTCTTGGCCAATATAGCTCGAGCTATATTGGCCAAGAGTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268680    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_020827.1-1795s21c1
Sequence:CCGGTCGTGCATATTCCTATAATTCCTCGAGGAATTATAGGAATATGCACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_020827.1-1726s21c1
Sequence:CCGGGTCCGTACAGCTTGGTTATAACTCGAGTTATAACCAAGCTGTACGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020827.1-598s21c1
Sequence:CCGGTCCGCTAAACCATCTACTAACCTCGAGGTTAGTAGATGGTTTAGCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)