EMAIL THIS PAGE TO A FRIEND

KIAA1432

KIAA1432

18 Gene Product Result for
Synonyms: CIP150 bA207C16.1
Gene ID:
domestic guinea pig(100717661) KIAA1432 ortholog
naked mole-rat(101721294) KIAA1432 ortholog
sheep(101115510) KIAA1432 ortholog
chicken(427226) KIAA1432
domestic cat(101088439) KIAA1432 ortholog
cow(506005) KIAA1432 ortholog
dog(484187) KIAA1432 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020829 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020829 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020829 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU065791 MISSION® esiRNA esiRNA human KIAA1432 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020829 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020829 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212983 predicted 2257
2 SASI_Hs01_00212984 predicted 317
3 SASI_Hs01_00212985 predicted 349
4 SASI_Hs01_00212987 predicted 2106
5 SASI_Hs01_00212988 predicted 3610
6 SASI_Hs01_00212989 predicted 1578
7 SASI_Hs01_00212990 predicted 888
8 SASI_Hs01_00212992 predicted 2789
9 SASI_Hs02_00354069 predicted 2940
10 SASI_Hs02_00354070 predicted 2707
11 SASI_Hs01_00212986 predicted 1190
12 SASI_Hs01_00212991 predicted 3628
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020829
VALIDATED
KIAA1432 MISSION shRNA Bacterial Glycerol Stock
KIAA1432
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_020829.2-2566s21c1
Sequence:CCGGTGTGCCAGGAAGACCGAATATCTCGAGATATTCGGTCTTCCTGGCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020829.2-4237s21c1
Sequence:CCGGTCGGTAAGTATTAGTAGATTTCTCGAGAAATCTACTAATACTTACCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_020829.2-2779s21c1
Sequence:CCGGTGTCGACACATGATTCGATTTCTCGAGAAATCGAATCATGTGTCGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_020829.2-1506s21c1
Sequence:CCGGTATGGTCCTTGCGTGTTATAACTCGAGTTATAACACGCAAGGACCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020829.1-2711s1c1
Sequence:CCGGCGACACATGATTCGATTTCTTCTCGAGAAGAAATCGAATCATGTGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020829.1-2603s1c1
Sequence:CCGGGCCTCTTACCTTATTATCTTACTCGAGTAAGATAATAAGGTAAGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020829
VALIDATED
KIAA1432 MISSION shRNA shRNA Plasmid DNA
KIAA1432
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_020829.2-2566s21c1
Sequence:CCGGTGTGCCAGGAAGACCGAATATCTCGAGATATTCGGTCTTCCTGGCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020829.2-4237s21c1
Sequence:CCGGTCGGTAAGTATTAGTAGATTTCTCGAGAAATCTACTAATACTTACCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_020829.2-2779s21c1
Sequence:CCGGTGTCGACACATGATTCGATTTCTCGAGAAATCGAATCATGTGTCGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_020829.2-1506s21c1
Sequence:CCGGTATGGTCCTTGCGTGTTATAACTCGAGTTATAACACGCAAGGACCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020829.1-2711s1c1
Sequence:CCGGCGACACATGATTCGATTTCTTCTCGAGAAGAAATCGAATCATGTGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020829.1-2603s1c1
Sequence:CCGGGCCTCTTACCTTATTATCTTACTCGAGTAAGATAATAAGGTAAGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020829
VALIDATED
KIAA1432 MISSION shRNA Lentiviral Transduction Particles
KIAA1432
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_020829.2-2566s21c1
Sequence:CCGGTGTGCCAGGAAGACCGAATATCTCGAGATATTCGGTCTTCCTGGCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020829.2-4237s21c1
Sequence:CCGGTCGGTAAGTATTAGTAGATTTCTCGAGAAATCTACTAATACTTACCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_020829.2-2779s21c1
Sequence:CCGGTGTCGACACATGATTCGATTTCTCGAGAAATCGAATCATGTGTCGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_020829.2-1506s21c1
Sequence:CCGGTATGGTCCTTGCGTGTTATAACTCGAGTTATAACACGCAAGGACCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020829.1-2711s1c1
Sequence:CCGGCGACACATGATTCGATTTCTTCTCGAGAAGAAATCGAATCATGTGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020829.1-2603s1c1
Sequence:CCGGGCCTCTTACCTTATTATCTTACTCGAGTAAGATAATAAGGTAAGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)