EMAIL THIS PAGE TO A FRIEND

KIAA1456

KIAA1456

99 Gene Product Result for
Synonyms: C8orf79 TRM9L
UniProtKB ID: Q8N9K7
Gene ID:
chicken(422741) KIAA1456
cow(510845) putative methyltransferase KIAA1456 homolog
domestic cat(101087057) KIAA1456 ortholog
dog(482887) KIAA1456 ortholog
sheep(101102121) KIAA1456 ortholog
domestic guinea pig(100732719) KIAA1456 ortholog
naked mole-rat(101700162) KIAA1456 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020844 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020844 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020844 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU036211 MISSION® esiRNA esiRNA human C8orf79 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099677 Rosetta Predictions human pricing
NM_020844 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099677 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321018 predicted 1015
2 SASI_Hs02_00321019 predicted 763
3 SASI_Hs02_00321020 predicted 1384
4 SASI_Hs02_00321021 predicted 1117
5 SASI_Hs02_00321022 predicted 1080
6 SASI_Hs02_00321023 predicted 1254
7 SASI_Hs02_00321024 predicted 1422
8 SASI_Hs02_00321025 predicted 1248
9 SASI_Hs02_00321026 predicted 1354
10 SASI_Hs02_00321027 predicted 1299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020844 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119477 predicted 1311
2 SASI_Hs01_00119478 predicted 1053
3 SASI_Hs01_00119479 predicted 1668
4 SASI_Hs01_00119480 predicted 1408
5 SASI_Hs01_00119481 predicted 1362
6 SASI_Hs01_00119482 predicted 1546
7 SASI_Hs01_00119484 predicted 1719
8 SASI_Hs01_00119485 predicted 1539
9 SASI_Hs01_00119483 predicted 1644
10 SASI_Hs02_00354094 predicted 1591
11 SASI_Hs01_00119486 predicted 613
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020844
KIAA1456 MISSION shRNA Bacterial Glycerol Stock
KIAA1456
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144663    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020844.1-5418s1c1
Sequence:CCGGGCCTTTCTATTTCCTTCCAAACTCGAGTTTGGAAGGAAATAGAAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020844.1-586s1c1
Sequence:CCGGCCATAGGAGTCATACATCATTCTCGAGAATGATGTATGACTCCTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143814    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020844.1-5447s1c1
Sequence:CCGGGCCAGTAATTCCTCTGTCTTTCTCGAGAAAGACAGAGGAATTACTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143219    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020844.1-1796s1c1
Sequence:CCGGGCACAGATTCTGGCATTGAAACTCGAGTTTCAATGCCAGAATCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020844.1-913s1c1
Sequence:CCGGGCTATGAACCTGCTATGGCAACTCGAGTTGCCATAGCAGGTTCATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020844.1-1245s1c1
Sequence:CCGGCCAGGCACTCTGAAACATTTACTCGAGTAAATGTTTCAGAGTGCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020844
KIAA1456 MISSION shRNA shRNA Plasmid DNA
KIAA1456
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144663    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020844.1-5418s1c1
Sequence:CCGGGCCTTTCTATTTCCTTCCAAACTCGAGTTTGGAAGGAAATAGAAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020844.1-586s1c1
Sequence:CCGGCCATAGGAGTCATACATCATTCTCGAGAATGATGTATGACTCCTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143814    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020844.1-5447s1c1
Sequence:CCGGGCCAGTAATTCCTCTGTCTTTCTCGAGAAAGACAGAGGAATTACTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143219    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020844.1-1796s1c1
Sequence:CCGGGCACAGATTCTGGCATTGAAACTCGAGTTTCAATGCCAGAATCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020844.1-913s1c1
Sequence:CCGGGCTATGAACCTGCTATGGCAACTCGAGTTGCCATAGCAGGTTCATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020844.1-1245s1c1
Sequence:CCGGCCAGGCACTCTGAAACATTTACTCGAGTAAATGTTTCAGAGTGCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020844
KIAA1456 MISSION shRNA Lentiviral Transduction Particles
KIAA1456
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144663    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020844.1-5418s1c1
Sequence:CCGGGCCTTTCTATTTCCTTCCAAACTCGAGTTTGGAAGGAAATAGAAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020844.1-586s1c1
Sequence:CCGGCCATAGGAGTCATACATCATTCTCGAGAATGATGTATGACTCCTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143814    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020844.1-5447s1c1
Sequence:CCGGGCCAGTAATTCCTCTGTCTTTCTCGAGAAAGACAGAGGAATTACTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143219    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020844.1-1796s1c1
Sequence:CCGGGCACAGATTCTGGCATTGAAACTCGAGTTTCAATGCCAGAATCTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020844.1-913s1c1
Sequence:CCGGGCTATGAACCTGCTATGGCAACTCGAGTTGCCATAGCAGGTTCATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020844.1-1245s1c1
Sequence:CCGGCCAGGCACTCTGAAACATTTACTCGAGTAAATGTTTCAGAGTGCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)