EMAIL THIS PAGE TO A FRIEND

KIAA1467

KIAA1467

78 Gene Product Result for
UniProtKB ID: A2RU67, Q49AF2, Q5CZ81, Q6ZUV7, Q9P261
Gene ID:
chicken(417963) KIAA1467
dog(486678) KIAA1467 ortholog
cow(512120) KIAA1467 ortholog
domestic cat(101082757) KIAA1467 ortholog
sheep(101118436) KIAA1467 ortholog
domestic guinea pig(100713012) KIAA1467 ortholog
naked mole-rat(101725382) KIAA1467 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020853 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020853 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020853 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU008381 MISSION® esiRNA esiRNA targeting human KIAA1467 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020853 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020853 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104728 predicted 470
2 SASI_Hs01_00104729 predicted 1666
3 SASI_Hs01_00104730 predicted 1838
4 SASI_Hs01_00104731 predicted 1936
5 SASI_Hs01_00104732 predicted 1321
6 SASI_Hs01_00104733 predicted 937
7 SASI_Hs01_00104734 predicted 1976
8 SASI_Hs01_00104735 predicted 799
9 SASI_Hs01_00104736 predicted 1473
10 SASI_Hs01_00104737 predicted 960
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020853
VALIDATED
KIAA1467 MISSION shRNA Bacterial Glycerol Stock
KIAA1467
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183262    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_020853.1-3142s1c1
Sequence:CCGGGCTTCTTGAATAACCTTGATACTCGAGTATCAAGGTTATTCAAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020853.1-3457s1c1
Sequence:CCGGCCTCAGATAATCCACCTGCTTCTCGAGAAGCAGGTGGATTATCTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_020853.1-1842s1c1
Sequence:CCGGCGAAGATTTCTCTCTAGGATACTCGAGTATCCTAGAGAGAAATCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146714    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_020853.1-2705s1c1
Sequence:CCGGCGACATCAGAAGTGTATGTTTCTCGAGAAACATACACTTCTGATGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020853.1-1310s1c1
Sequence:CCGGCCAGCCTACTCCTGGATATTTCTCGAGAAATATCCAGGAGTAGGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020853
VALIDATED
KIAA1467 MISSION shRNA shRNA Plasmid DNA
KIAA1467
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183262    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_020853.1-3142s1c1
Sequence:CCGGGCTTCTTGAATAACCTTGATACTCGAGTATCAAGGTTATTCAAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020853.1-3457s1c1
Sequence:CCGGCCTCAGATAATCCACCTGCTTCTCGAGAAGCAGGTGGATTATCTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_020853.1-1842s1c1
Sequence:CCGGCGAAGATTTCTCTCTAGGATACTCGAGTATCCTAGAGAGAAATCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146714    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_020853.1-2705s1c1
Sequence:CCGGCGACATCAGAAGTGTATGTTTCTCGAGAAACATACACTTCTGATGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020853.1-1310s1c1
Sequence:CCGGCCAGCCTACTCCTGGATATTTCTCGAGAAATATCCAGGAGTAGGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020853
VALIDATED
KIAA1467 MISSION shRNA Lentiviral Transduction Particles
KIAA1467
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183262    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_020853.1-3142s1c1
Sequence:CCGGGCTTCTTGAATAACCTTGATACTCGAGTATCAAGGTTATTCAAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020853.1-3457s1c1
Sequence:CCGGCCTCAGATAATCCACCTGCTTCTCGAGAAGCAGGTGGATTATCTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_020853.1-1842s1c1
Sequence:CCGGCGAAGATTTCTCTCTAGGATACTCGAGTATCCTAGAGAGAAATCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146714    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_020853.1-2705s1c1
Sequence:CCGGCGACATCAGAAGTGTATGTTTCTCGAGAAACATACACTTCTGATGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020853.1-1310s1c1
Sequence:CCGGCCAGCCTACTCCTGGATATTTCTCGAGAAATATCCAGGAGTAGGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)