EMAIL THIS PAGE TO A FRIEND

KIAA1522

KIAA1522

52 Gene Product Result for
UniProtKB ID: Q9P206, B4DQU8, B5MDY0, C9JH84, Q8TCQ0
Gene ID:
chicken(419665) KIAA1522
cow(788353) KIAA1522 ortholog
domestic cat(101101488) KIAA1522 ortholog
dog(611800) KIAA1522 ortholog
sheep(101105225) KIAA1522 ortholog
domestic guinea pig(100727400) KIAA1522 ortholog
naked mole-rat(101722669) KIAA1522 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020888 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020888 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020888 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020888 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020888 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238615 predicted 602
2 SASI_Hs01_00238616 predicted 1290
3 SASI_Hs01_00238617 predicted 1504
4 SASI_Hs01_00238618 predicted 2934
5 SASI_Hs01_00238619 predicted 912
6 SASI_Hs01_00238620 predicted 1766
7 SASI_Hs01_00238621 predicted 3222
8 SASI_Hs01_00238622 predicted 1365
9 SASI_Hs01_00238623 predicted 1009
10 SASI_Hs01_00238624 predicted 3189
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020888
VALIDATED
KIAA1522 MISSION shRNA Bacterial Glycerol Stock
KIAA1522
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020888.2-1372s21c1
Sequence:CCGGAGAGCTCTACGGCTAGCAATACTCGAGTATTGCTAGCCGTAGAGCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415930    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020888.2-3457s21c1
Sequence:CCGGCCACGGCCTTCGATACTTATGCTCGAGCATAAGTATCGAAGGCCGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020888.2-3658s21c1
Sequence:CCGGCACCTCACCTGAGTTTCATTTCTCGAGAAATGAAACTCAGGTGAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020888.2-1090s21c1
Sequence:CCGGCCTACCTGTCGAAGTTGATTCCTCGAGGAATCAACTTCGACAGGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020888.2-3690s21c1
Sequence:CCGGCAAACCATGCACATACTATAGCTCGAGCTATAGTATGTGCATGGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020888.1-174s1c1
Sequence:CCGGCTGAGAATGACAAACATCTAACTCGAGTTAGATGTTTGTCATTCTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167138    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020888.1-4958s1c1
Sequence:CCGGCCAACATTACTGGAACTCTATCTCGAGATAGAGTTCCAGTAATGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020888.1-242s1c1
Sequence:CCGGGACAACGTCTTCTTTCCCAGTCTCGAGACTGGGAAAGAAGACGTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020888.1-146s1c1
Sequence:CCGGCTGTTTAAGAAGAAGGGCTCTCTCGAGAGAGCCCTTCTTCTTAAACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020888.1-1806s1c1
Sequence:CCGGCCTCTTCCCTCACGTCTTTATCTCGAGATAAAGACGTGAGGGAAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020888.1-2969s1c1
Sequence:CCGGCCAAAGAAGTCACCTAAGGCTCTCGAGAGCCTTAGGTGACTTCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020888
VALIDATED
KIAA1522 MISSION shRNA shRNA Plasmid DNA
KIAA1522
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020888.2-1372s21c1
Sequence:CCGGAGAGCTCTACGGCTAGCAATACTCGAGTATTGCTAGCCGTAGAGCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415930    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020888.2-3457s21c1
Sequence:CCGGCCACGGCCTTCGATACTTATGCTCGAGCATAAGTATCGAAGGCCGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020888.2-3658s21c1
Sequence:CCGGCACCTCACCTGAGTTTCATTTCTCGAGAAATGAAACTCAGGTGAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020888.2-1090s21c1
Sequence:CCGGCCTACCTGTCGAAGTTGATTCCTCGAGGAATCAACTTCGACAGGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020888.2-3690s21c1
Sequence:CCGGCAAACCATGCACATACTATAGCTCGAGCTATAGTATGTGCATGGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020888.1-174s1c1
Sequence:CCGGCTGAGAATGACAAACATCTAACTCGAGTTAGATGTTTGTCATTCTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167138    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020888.1-4958s1c1
Sequence:CCGGCCAACATTACTGGAACTCTATCTCGAGATAGAGTTCCAGTAATGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020888.1-242s1c1
Sequence:CCGGGACAACGTCTTCTTTCCCAGTCTCGAGACTGGGAAAGAAGACGTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020888.1-146s1c1
Sequence:CCGGCTGTTTAAGAAGAAGGGCTCTCTCGAGAGAGCCCTTCTTCTTAAACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020888.1-1806s1c1
Sequence:CCGGCCTCTTCCCTCACGTCTTTATCTCGAGATAAAGACGTGAGGGAAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020888.1-2969s1c1
Sequence:CCGGCCAAAGAAGTCACCTAAGGCTCTCGAGAGCCTTAGGTGACTTCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020888
VALIDATED
KIAA1522 MISSION shRNA Lentiviral Transduction Particles
KIAA1522
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020888.2-1372s21c1
Sequence:CCGGAGAGCTCTACGGCTAGCAATACTCGAGTATTGCTAGCCGTAGAGCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415930    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020888.2-3457s21c1
Sequence:CCGGCCACGGCCTTCGATACTTATGCTCGAGCATAAGTATCGAAGGCCGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020888.2-3658s21c1
Sequence:CCGGCACCTCACCTGAGTTTCATTTCTCGAGAAATGAAACTCAGGTGAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020888.2-1090s21c1
Sequence:CCGGCCTACCTGTCGAAGTTGATTCCTCGAGGAATCAACTTCGACAGGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020888.2-3690s21c1
Sequence:CCGGCAAACCATGCACATACTATAGCTCGAGCTATAGTATGTGCATGGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020888.1-174s1c1
Sequence:CCGGCTGAGAATGACAAACATCTAACTCGAGTTAGATGTTTGTCATTCTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167138    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020888.1-4958s1c1
Sequence:CCGGCCAACATTACTGGAACTCTATCTCGAGATAGAGTTCCAGTAATGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020888.1-242s1c1
Sequence:CCGGGACAACGTCTTCTTTCCCAGTCTCGAGACTGGGAAAGAAGACGTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020888.1-146s1c1
Sequence:CCGGCTGTTTAAGAAGAAGGGCTCTCTCGAGAGAGCCCTTCTTCTTAAACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020888.1-1806s1c1
Sequence:CCGGCCTCTTCCCTCACGTCTTTATCTCGAGATAAAGACGTGAGGGAAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020888.1-2969s1c1
Sequence:CCGGCCAAAGAAGTCACCTAAGGCTCTCGAGAGCCTTAGGTGACTTCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)