EMAIL THIS PAGE TO A FRIEND

KIAA1524

KIAA1524

27 Gene Product Result for
Synonyms: CIP2A p90
Gene ID:
domestic guinea pig(100729170) KIAA1524 ortholog
naked mole-rat(101709541) KIAA1524 ortholog
sheep(101115924) KIAA1524 ortholog
chicken(418410) KIAA1524
dog(478554) KIAA1524 ortholog
cow(538580) KIAA1524 ortholog
domestic cat(101081243) KIAA1524 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020890 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020890 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020890 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU157631 MISSION® esiRNA esiRNA human KIAA1524 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020890 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020890 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190106 predicted 467
2 SASI_Hs02_00354200 predicted 999
3 SASI_Hs01_00190108 predicted 1394
4 SASI_Hs01_00190109 predicted 1582
5 SASI_Hs01_00190111 predicted 2315
6 SASI_Hs02_00354201 predicted 524
7 SASI_Hs01_00190112 predicted 784
8 SASI_Hs02_00354202 predicted 1433
9 SASI_Hs01_00190115 predicted 501
10 SASI_Hs02_00354203 predicted 1545
11 SASI_Hs01_00190107 predicted 1910
12 SASI_Hs01_00190110 predicted 437
13 SASI_Hs01_00190113 predicted 2867
14 SASI_Hs01_00190114 predicted 2460
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020890
VALIDATED
KIAA1524 MISSION shRNA Bacterial Glycerol Stock
KIAA1524
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_020890.2-3070s21c1
Sequence:CCGGATTTGTGACTTCGTAACAATACTCGAGTATTGTTACGAAGTCACAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_020890.2-358s21c1
Sequence:CCGGTGCGGCACTTGGAGGTAATTTCTCGAGAAATTACCTCCAAGTGCCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_020890.2-2648s21c1
Sequence:CCGGGCTAGTAGACAGAGAACATAACTCGAGTTATGTTCTCTGTCTACTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_020890.2-2353s21c1
Sequence:CCGGCGCAGCAAGTTGAATCAGAAACTCGAGTTTCTGATTCAACTTGCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020890.1-2152s1c1
Sequence:CCGGCGCAGCAAGTTGAATCAGAAACTCGAGTTTCTGATTCAACTTGCTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020890.1-2447s1c1
Sequence:CCGGGCTAGTAGACAGAGAACATAACTCGAGTTATGTTCTCTGTCTACTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020890.1-312s1c1
Sequence:CCGGCAACTAGCAGTAGACATTGAACTCGAGTTCAATGTCTACTGCTAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_020890.1-2094s1c1
Sequence:CCGGGCTAGTATGTTGAGAGAAGTTCTCGAGAACTTCTCTCAACATACTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_020890.1-2732s1c1
Sequence:CCGGCCACAGTTTAAGTGGTGGAAACTCGAGTTTCCACCACTTAAACTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020890.1-2151s1c1
Sequence:CCGGGCGCAGCAAGTTGAATCAGAACTCGAGTTCTGATTCAACTTGCTGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_020890.1-181s1c1
Sequence:CCGGGACAGAAACTCACACGACTATCTCGAGATAGTCGTGTGAGTTTCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_020890.2-382s21c1
Sequence:CCGGGACAGAAACTCACACGACTATCTCGAGATAGTCGTGTGAGTTTCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020890
VALIDATED
KIAA1524 MISSION shRNA shRNA Plasmid DNA
KIAA1524
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_020890.2-3070s21c1
Sequence:CCGGATTTGTGACTTCGTAACAATACTCGAGTATTGTTACGAAGTCACAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_020890.2-358s21c1
Sequence:CCGGTGCGGCACTTGGAGGTAATTTCTCGAGAAATTACCTCCAAGTGCCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_020890.2-2648s21c1
Sequence:CCGGGCTAGTAGACAGAGAACATAACTCGAGTTATGTTCTCTGTCTACTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_020890.2-2353s21c1
Sequence:CCGGCGCAGCAAGTTGAATCAGAAACTCGAGTTTCTGATTCAACTTGCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020890.1-2152s1c1
Sequence:CCGGCGCAGCAAGTTGAATCAGAAACTCGAGTTTCTGATTCAACTTGCTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020890.1-2447s1c1
Sequence:CCGGGCTAGTAGACAGAGAACATAACTCGAGTTATGTTCTCTGTCTACTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020890.1-312s1c1
Sequence:CCGGCAACTAGCAGTAGACATTGAACTCGAGTTCAATGTCTACTGCTAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_020890.1-2094s1c1
Sequence:CCGGGCTAGTATGTTGAGAGAAGTTCTCGAGAACTTCTCTCAACATACTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_020890.1-2732s1c1
Sequence:CCGGCCACAGTTTAAGTGGTGGAAACTCGAGTTTCCACCACTTAAACTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020890.1-2151s1c1
Sequence:CCGGGCGCAGCAAGTTGAATCAGAACTCGAGTTCTGATTCAACTTGCTGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_020890.1-181s1c1
Sequence:CCGGGACAGAAACTCACACGACTATCTCGAGATAGTCGTGTGAGTTTCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_020890.2-382s21c1
Sequence:CCGGGACAGAAACTCACACGACTATCTCGAGATAGTCGTGTGAGTTTCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020890
VALIDATED
KIAA1524 MISSION shRNA Lentiviral Transduction Particles
KIAA1524
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_020890.2-3070s21c1
Sequence:CCGGATTTGTGACTTCGTAACAATACTCGAGTATTGTTACGAAGTCACAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_020890.2-358s21c1
Sequence:CCGGTGCGGCACTTGGAGGTAATTTCTCGAGAAATTACCTCCAAGTGCCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_020890.2-2648s21c1
Sequence:CCGGGCTAGTAGACAGAGAACATAACTCGAGTTATGTTCTCTGTCTACTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_020890.2-2353s21c1
Sequence:CCGGCGCAGCAAGTTGAATCAGAAACTCGAGTTTCTGATTCAACTTGCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020890.1-2152s1c1
Sequence:CCGGCGCAGCAAGTTGAATCAGAAACTCGAGTTTCTGATTCAACTTGCTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020890.1-2447s1c1
Sequence:CCGGGCTAGTAGACAGAGAACATAACTCGAGTTATGTTCTCTGTCTACTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020890.1-312s1c1
Sequence:CCGGCAACTAGCAGTAGACATTGAACTCGAGTTCAATGTCTACTGCTAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_020890.1-2094s1c1
Sequence:CCGGGCTAGTATGTTGAGAGAAGTTCTCGAGAACTTCTCTCAACATACTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_020890.1-2732s1c1
Sequence:CCGGCCACAGTTTAAGTGGTGGAAACTCGAGTTTCCACCACTTAAACTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020890.1-2151s1c1
Sequence:CCGGGCGCAGCAAGTTGAATCAGAACTCGAGTTCTGATTCAACTTGCTGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_020890.1-181s1c1
Sequence:CCGGGACAGAAACTCACACGACTATCTCGAGATAGTCGTGTGAGTTTCTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_020890.2-382s21c1
Sequence:CCGGGACAGAAACTCACACGACTATCTCGAGATAGTCGTGTGAGTTTCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)