EMAIL THIS PAGE TO A FRIEND

KIAA1549

KIAA1549

103 Gene Product Result for
Gene ID:
Human(57670) Summary: The protein encoded by this gene belongs to the UPF0606 family. This gene has been found to be fused to the BRAF oncogene in many cases of pilocytic astrocytoma. The fusion results from 2Mb tandem duplications at 7q34. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
domestic cat(101089845) KIAA1549 ortholog
dog(482778) KIAA1549 ortholog
cow(512679) KIAA1549 ortholog
sheep(101109533) KIAA1549 ortholog
domestic guinea pig(100720547) KIAA1549 ortholog
naked mole-rat(101707592) KIAA1549 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA019560 Anti-KIAA1549 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2106790 Anti-KIAA1549 antibody produced in rabbit affinity isolated antibody horse, guinea pig, human, rabbit
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020910 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020910 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020910 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_371956 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_371956 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_371956 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU144391 MISSION® esiRNA esiRNA human KIAA1549 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020910 Rosetta Predictions human pricing
XM_371956 Rosetta Predictions human pricing
XM_935389 Rosetta Predictions human pricing
XM_935390 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020910 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354256 predicted 1725
2 SASI_Hs02_00354257 predicted 465
3 SASI_Hs02_00354258 predicted 4567
4 SASI_Hs02_00354259 predicted 1315
5 SASI_Hs02_00354260 predicted 4079
6 SASI_Hs02_00354261 predicted 348
7 SASI_Hs02_00354262 predicted 4241
8 SASI_Hs02_00354263 predicted 3246
9 SASI_Hs02_00354264 predicted 4201
10 SASI_Hs02_00354265 predicted 1685
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371956 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00268896 predicted 1633
2 SASI_Hs01_00268897 predicted 373
3 SASI_Hs01_00268898 predicted 4482
4 SASI_Hs01_00268899 predicted 3990
5 SASI_Hs01_00268900 predicted 4146
6 SASI_Hs01_00268901 predicted 2276
7 SASI_Hs01_00268902 predicted 3148
8 SASI_Hs01_00268903 predicted 4113
9 SASI_Hs01_00268904 predicted 1596
10 SASI_Hs01_00268905 predicted 2731
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935389 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00289597 predicted 1631
2 SASI_Hs01_00289598 predicted 370
3 SASI_Hs01_00289599 predicted 4479
4 SASI_Hs01_00289600 predicted 3988
5 SASI_Hs01_00289601 predicted 4144
6 SASI_Hs01_00289602 predicted 2285
7 SASI_Hs01_00289603 predicted 3146
8 SASI_Hs01_00289604 predicted 4114
9 SASI_Hs01_00289605 predicted 1589
10 SASI_Hs01_00289606 predicted 2721
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935390 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00255649 predicted 438
2 SASI_Hs01_00255650 predicted 508
3 SASI_Hs01_00255651 predicted 915
4 SASI_Hs01_00255652 predicted 636
5 SASI_Hs01_00255653 predicted 418
6 SASI_Hs01_00255654 predicted 580
7 SASI_Hs01_00255655 predicted 275
8 SASI_Hs01_00255656 predicted 2412
9 SASI_Hs01_00255657 predicted 480
10 SASI_Hs01_00255658 predicted 277
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020910
KIAA1549 MISSION shRNA Bacterial Glycerol Stock
KIAA1549
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000439461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020910.2-3292s21c1
Sequence:CCGGACACCACCAGGGAACGTATAACTCGAGTTATACGTTCCCTGGTGGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020910.2-3010s21c1
Sequence:CCGGACTGAAGGTTTACGAACTATTCTCGAGAATAGTTCGTAAACCTTCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020910.2-4135s21c1
Sequence:CCGGGCACAATAAAGACGACATATTCTCGAGAATATGTCGTCTTTATTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020910.2-3516s21c1
Sequence:CCGGAGTATCCACAGCTCAACTTATCTCGAGATAAGTTGAGCTGTGGATACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020910
KIAA1549 MISSION shRNA shRNA Plasmid DNA
KIAA1549
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000439461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020910.2-3292s21c1
Sequence:CCGGACACCACCAGGGAACGTATAACTCGAGTTATACGTTCCCTGGTGGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020910.2-3010s21c1
Sequence:CCGGACTGAAGGTTTACGAACTATTCTCGAGAATAGTTCGTAAACCTTCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020910.2-4135s21c1
Sequence:CCGGGCACAATAAAGACGACATATTCTCGAGAATATGTCGTCTTTATTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020910.2-3516s21c1
Sequence:CCGGAGTATCCACAGCTCAACTTATCTCGAGATAAGTTGAGCTGTGGATACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020910
KIAA1549 MISSION shRNA Lentiviral Transduction Particles
KIAA1549
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000439461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020910.2-3292s21c1
Sequence:CCGGACACCACCAGGGAACGTATAACTCGAGTTATACGTTCCCTGGTGGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020910.2-3010s21c1
Sequence:CCGGACTGAAGGTTTACGAACTATTCTCGAGAATAGTTCGTAAACCTTCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020910.2-4135s21c1
Sequence:CCGGGCACAATAAAGACGACATATTCTCGAGAATATGTCGTCTTTATTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020910.2-3516s21c1
Sequence:CCGGAGTATCCACAGCTCAACTTATCTCGAGATAAGTTGAGCTGTGGATACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_371956
VALIDATED
KIAA1549 MISSION shRNA Bacterial Glycerol Stock
KIAA1549
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:XM_371956.2-4078s1c1
Sequence:CCGGCGCACAGACAAGCTAGACTTTCTCGAGAAAGTCTAGCTTGTCTGTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:XM_371956.2-2271s1c1
Sequence:CCGGCCCTTCTGATTCTCTCGAGTTCTCGAGAACTCGAGAGAATCAGAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371956.2-1537s1c1
Sequence:CCGGCCTCAAGTATTTAATACGCTTCTCGAGAAGCGTATTAAATACTTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371956.2-509s1c1
Sequence:CCGGCCAGCATCTTTGTGGCAACTTCTCGAGAAGTTGCCACAAAGATGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371956.2-3140s1c1
Sequence:CCGGCCGTCATAAATGTGCTTATAACTCGAGTTATAAGCACATTTATGACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_371956
VALIDATED
KIAA1549 MISSION shRNA shRNA Plasmid DNA
KIAA1549
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:XM_371956.2-4078s1c1
Sequence:CCGGCGCACAGACAAGCTAGACTTTCTCGAGAAAGTCTAGCTTGTCTGTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:XM_371956.2-2271s1c1
Sequence:CCGGCCCTTCTGATTCTCTCGAGTTCTCGAGAACTCGAGAGAATCAGAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371956.2-1537s1c1
Sequence:CCGGCCTCAAGTATTTAATACGCTTCTCGAGAAGCGTATTAAATACTTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371956.2-509s1c1
Sequence:CCGGCCAGCATCTTTGTGGCAACTTCTCGAGAAGTTGCCACAAAGATGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371956.2-3140s1c1
Sequence:CCGGCCGTCATAAATGTGCTTATAACTCGAGTTATAAGCACATTTATGACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_371956
VALIDATED
KIAA1549 MISSION shRNA Lentiviral Transduction Particles
KIAA1549
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:XM_371956.2-4078s1c1
Sequence:CCGGCGCACAGACAAGCTAGACTTTCTCGAGAAAGTCTAGCTTGTCTGTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:XM_371956.2-2271s1c1
Sequence:CCGGCCCTTCTGATTCTCTCGAGTTCTCGAGAACTCGAGAGAATCAGAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371956.2-1537s1c1
Sequence:CCGGCCTCAAGTATTTAATACGCTTCTCGAGAAGCGTATTAAATACTTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371956.2-509s1c1
Sequence:CCGGCCAGCATCTTTGTGGCAACTTCTCGAGAAGTTGCCACAAAGATGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371956.2-3140s1c1
Sequence:CCGGCCGTCATAAATGTGCTTATAACTCGAGTTATAAGCACATTTATGACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)