EMAIL THIS PAGE TO A FRIEND

KIAA1549L

KIAA1549-like

28 Gene Product Result for
Synonyms: C11orf41 C11orf69 G2
UniProtKB ID: Q6ZVL6, B0QYU0
Gene ID:
domestic guinea pig(100733938) KIAA1549-like ortholog
naked mole-rat(101704702) KIAA1549-like ortholog
sheep(101102174) KIAA1549-like ortholog
domestic cat(101091728) KIAA1549-like ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012194 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012194 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012194 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU144261 MISSION® esiRNA esiRNA human C11orf41 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012194 Rosetta Predictions human pricing
XM_039515 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012194 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343830 predicted 5770
2 SASI_Hs02_00343831 predicted 1425
3 SASI_Hs02_00343832 predicted 1555
4 SASI_Hs02_00343833 predicted 2609
5 SASI_Hs02_00343834 predicted 5756
6 SASI_Hs02_00343835 predicted 2161
7 SASI_Hs02_00343836 predicted 3658
8 SASI_Hs02_00343837 predicted 727
9 SASI_Hs02_00343838 predicted 2771
10 SASI_Hs02_00343839 predicted 5220
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_039515 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00281829 predicted 6342
2 SASI_Hs01_00281830 predicted 2137
3 SASI_Hs01_00281831 predicted 4235
4 SASI_Hs01_00281832 predicted 2721
5 SASI_Hs01_00281833 predicted 4217
6 SASI_Hs01_00281834 predicted 1313
7 SASI_Hs01_00281835 predicted 306
8 SASI_Hs01_00281836 predicted 3335
9 SASI_Hs01_00281837 predicted 5785
10 SASI_Hs01_00281838 predicted 259
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012194
KIAA1549L MISSION shRNA Bacterial Glycerol Stock
KIAA1549-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012194.1-3519s21c1
Sequence:CCGGCAGCGGAGCTGACTTACTATACTCGAGTATAGTAAGTCAGCTCCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012194.1-6152s21c1
Sequence:CCGGACCATGACCGTGCGCATTAAACTCGAGTTTAATGCGCACGGTCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012194.1-2024s21c1
Sequence:CCGGGCGGACACAGTATCATCTAAGCTCGAGCTTAGATGATACTGTGTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012194.1-5229s21c1
Sequence:CCGGAGTTGGATCAGTCGGCTTTAACTCGAGTTAAAGCCGACTGATCCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012194.1-3306s21c1
Sequence:CCGGCCAGAGACTATTGGGTAATTACTCGAGTAATTACCCAATAGTCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012194
KIAA1549L MISSION shRNA shRNA Plasmid DNA
KIAA1549-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012194.1-3519s21c1
Sequence:CCGGCAGCGGAGCTGACTTACTATACTCGAGTATAGTAAGTCAGCTCCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012194.1-6152s21c1
Sequence:CCGGACCATGACCGTGCGCATTAAACTCGAGTTTAATGCGCACGGTCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012194.1-2024s21c1
Sequence:CCGGGCGGACACAGTATCATCTAAGCTCGAGCTTAGATGATACTGTGTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012194.1-5229s21c1
Sequence:CCGGAGTTGGATCAGTCGGCTTTAACTCGAGTTAAAGCCGACTGATCCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012194.1-3306s21c1
Sequence:CCGGCCAGAGACTATTGGGTAATTACTCGAGTAATTACCCAATAGTCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012194
KIAA1549L MISSION shRNA Lentiviral Transduction Particles
KIAA1549-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012194.1-3519s21c1
Sequence:CCGGCAGCGGAGCTGACTTACTATACTCGAGTATAGTAAGTCAGCTCCGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012194.1-6152s21c1
Sequence:CCGGACCATGACCGTGCGCATTAAACTCGAGTTTAATGCGCACGGTCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012194.1-2024s21c1
Sequence:CCGGGCGGACACAGTATCATCTAAGCTCGAGCTTAGATGATACTGTGTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012194.1-5229s21c1
Sequence:CCGGAGTTGGATCAGTCGGCTTTAACTCGAGTTAAAGCCGACTGATCCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012194.1-3306s21c1
Sequence:CCGGCCAGAGACTATTGGGTAATTACTCGAGTAATTACCCAATAGTCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)