EMAIL THIS PAGE TO A FRIEND

KIAA1551

KIAA1551

65 Gene Product Result for
Synonyms: C12orf35
UniProtKB ID: Q9HCM1, B2RTU5, Q4KN17, Q9NVL6, Q9NWP9
Gene ID:
domestic cat(101089528) KIAA1551 ortholog
sheep(101106510) KIAA1551 ortholog
domestic guinea pig(100735081) KIAA1551 ortholog
naked mole-rat(101716073) KIAA1551 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018169 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018169 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018169 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU046991 MISSION® esiRNA esiRNA human C12orf35 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018169 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018169 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351420 predicted 4394
2 SASI_Hs01_00223503 predicted 3482
3 SASI_Hs01_00223504 predicted 2858
4 SASI_Hs01_00223505 predicted 1062
5 SASI_Hs01_00223508 predicted 1699
6 SASI_Hs02_00351421 predicted 1119
7 SASI_Hs01_00223510 predicted 1023
8 SASI_Hs02_00351422 predicted 4991
9 SASI_Hs01_00223511 predicted 1407
10 SASI_Hs02_00351423 predicted 2707
11 SASI_Hs01_00223506 predicted 4611
12 SASI_Hs01_00223507 predicted 2772
13 SASI_Hs01_00223509 predicted 4509
14 SASI_Hs01_00223512 predicted 4216
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018169
VALIDATED
KIAA1551 MISSION shRNA Bacterial Glycerol Stock
KIAA1551
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018169.3-841s21c1
Sequence:CCGGGGAGCTAACGTACCCAATATGCTCGAGCATATTGGGTACGTTAGCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018169.3-1129s21c1
Sequence:CCGGCATACATCATTGCAAGTTAAACTCGAGTTTAACTTGCAATGATGTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018169.3-4543s21c1
Sequence:CCGGTTAGACCAAGGGAACGTATTACTCGAGTAATACGTTCCCTTGGTCTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018169.1-356s1c1
Sequence:CCGGGCAGGTTGAAAGTTGTGGGAACTCGAGTTCCCACAACTTTCAACCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018169.1-891s1c1
Sequence:CCGGCCTCTGCAAGTTTCAGGAATACTCGAGTATTCCTGAAACTTGCAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018169.1-830s1c1
Sequence:CCGGGAATACAAACTCTGTGGAAGACTCGAGTCTTCCACAGAGTTTGTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_018169.1-1026s1c1
Sequence:CCGGGATGGATTTGAGATGCTACAACTCGAGTTGTAGCATCTCAAATCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018169.1-260s1c1
Sequence:CCGGGCATAAAGAAGCTCCGAGTAACTCGAGTTACTCGGAGCTTCTTTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018169
VALIDATED
KIAA1551 MISSION shRNA shRNA Plasmid DNA
KIAA1551
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018169.3-841s21c1
Sequence:CCGGGGAGCTAACGTACCCAATATGCTCGAGCATATTGGGTACGTTAGCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018169.3-1129s21c1
Sequence:CCGGCATACATCATTGCAAGTTAAACTCGAGTTTAACTTGCAATGATGTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018169.3-4543s21c1
Sequence:CCGGTTAGACCAAGGGAACGTATTACTCGAGTAATACGTTCCCTTGGTCTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018169.1-356s1c1
Sequence:CCGGGCAGGTTGAAAGTTGTGGGAACTCGAGTTCCCACAACTTTCAACCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018169.1-891s1c1
Sequence:CCGGCCTCTGCAAGTTTCAGGAATACTCGAGTATTCCTGAAACTTGCAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018169.1-830s1c1
Sequence:CCGGGAATACAAACTCTGTGGAAGACTCGAGTCTTCCACAGAGTTTGTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_018169.1-1026s1c1
Sequence:CCGGGATGGATTTGAGATGCTACAACTCGAGTTGTAGCATCTCAAATCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018169.1-260s1c1
Sequence:CCGGGCATAAAGAAGCTCCGAGTAACTCGAGTTACTCGGAGCTTCTTTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018169
VALIDATED
KIAA1551 MISSION shRNA Lentiviral Transduction Particles
KIAA1551
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018169.3-841s21c1
Sequence:CCGGGGAGCTAACGTACCCAATATGCTCGAGCATATTGGGTACGTTAGCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018169.3-1129s21c1
Sequence:CCGGCATACATCATTGCAAGTTAAACTCGAGTTTAACTTGCAATGATGTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018169.3-4543s21c1
Sequence:CCGGTTAGACCAAGGGAACGTATTACTCGAGTAATACGTTCCCTTGGTCTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018169.1-356s1c1
Sequence:CCGGGCAGGTTGAAAGTTGTGGGAACTCGAGTTCCCACAACTTTCAACCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018169.1-891s1c1
Sequence:CCGGCCTCTGCAAGTTTCAGGAATACTCGAGTATTCCTGAAACTTGCAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018169.1-830s1c1
Sequence:CCGGGAATACAAACTCTGTGGAAGACTCGAGTCTTCCACAGAGTTTGTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_018169.1-1026s1c1
Sequence:CCGGGATGGATTTGAGATGCTACAACTCGAGTTGTAGCATCTCAAATCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018169.1-260s1c1
Sequence:CCGGGCATAAAGAAGCTCCGAGTAACTCGAGTTACTCGGAGCTTCTTTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)