EMAIL THIS PAGE TO A FRIEND

KIAA1586

KIAA1586

31 Gene Product Result for
UniProtKB ID: Q9HCI6, A8K4M3, Q8IW25
Gene ID:
naked mole-rat(101717969) KIAA1586 ortholog
sheep(101112520) KIAA1586 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302819 ANTI-KIAA1586 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
HPA036370 Anti-KIAA1586 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020931 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020931 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020931 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU042751 MISSION® esiRNA esiRNA human KIAA1586 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020931 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020931 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354319 predicted 1128
2 SASI_Hs01_00112185 predicted 2067
3 SASI_Hs01_00112186 predicted 1909
4 SASI_Hs01_00112187 predicted 1241
5 SASI_Hs01_00112188 predicted 1786
6 SASI_Hs02_00354320 predicted 1918
7 SASI_Hs01_00112189 predicted 335
8 SASI_Hs01_00112190 predicted 1977
9 SASI_Hs01_00112191 predicted 1912
10 SASI_Hs01_00112192 predicted 1800
11 SASI_Hs01_00112184 predicted 549
12 SASI_Hs01_00112193 predicted 1207
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020931
VALIDATED
KIAA1586 MISSION shRNA Bacterial Glycerol Stock
KIAA1586
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000268844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020931.2-483s21c1
Sequence:CCGGGAACCACATTTCGAGTATATTCTCGAGAATATACTCGAAATGTGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020931.2-2725s21c1
Sequence:CCGGTTGCTAGAGTGGGTCATAATACTCGAGTATTATGACCCACTCTAGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020931.1-504s1c1
Sequence:CCGGGAACAACCAATCATTGAAGAACTCGAGTTCTTCAATGATTGGTTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020931.2-1452s21c1
Sequence:CCGGGATGATTCTATATCCGAAATACTCGAGTATTTCGGATATAGAATCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020931.2-1799s21c1
Sequence:CCGGACAGTCAAGATCAACTAATATCTCGAGATATTAGTTGATCTTGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020931.2-1655s21c1
Sequence:CCGGATGGCATGCATATCCTATATTCTCGAGAATATAGGATATGCATGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167850    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020931.1-2654s1c1
Sequence:CCGGGCGTTCTTTAAGAAGATAATCCTCGAGGATTATCTTCTTAAAGAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020931
VALIDATED
KIAA1586 MISSION shRNA shRNA Plasmid DNA
KIAA1586
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000268844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020931.2-483s21c1
Sequence:CCGGGAACCACATTTCGAGTATATTCTCGAGAATATACTCGAAATGTGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020931.2-2725s21c1
Sequence:CCGGTTGCTAGAGTGGGTCATAATACTCGAGTATTATGACCCACTCTAGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020931.1-504s1c1
Sequence:CCGGGAACAACCAATCATTGAAGAACTCGAGTTCTTCAATGATTGGTTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020931.2-1452s21c1
Sequence:CCGGGATGATTCTATATCCGAAATACTCGAGTATTTCGGATATAGAATCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020931.2-1799s21c1
Sequence:CCGGACAGTCAAGATCAACTAATATCTCGAGATATTAGTTGATCTTGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020931.2-1655s21c1
Sequence:CCGGATGGCATGCATATCCTATATTCTCGAGAATATAGGATATGCATGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167850    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020931.1-2654s1c1
Sequence:CCGGGCGTTCTTTAAGAAGATAATCCTCGAGGATTATCTTCTTAAAGAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020931
VALIDATED
KIAA1586 MISSION shRNA Lentiviral Transduction Particles
KIAA1586
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000268844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020931.2-483s21c1
Sequence:CCGGGAACCACATTTCGAGTATATTCTCGAGAATATACTCGAAATGTGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020931.2-2725s21c1
Sequence:CCGGTTGCTAGAGTGGGTCATAATACTCGAGTATTATGACCCACTCTAGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020931.1-504s1c1
Sequence:CCGGGAACAACCAATCATTGAAGAACTCGAGTTCTTCAATGATTGGTTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020931.2-1452s21c1
Sequence:CCGGGATGATTCTATATCCGAAATACTCGAGTATTTCGGATATAGAATCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020931.2-1799s21c1
Sequence:CCGGACAGTCAAGATCAACTAATATCTCGAGATATTAGTTGATCTTGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020931.2-1655s21c1
Sequence:CCGGATGGCATGCATATCCTATATTCTCGAGAATATAGGATATGCATGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167850    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020931.1-2654s1c1
Sequence:CCGGGCGTTCTTTAAGAAGATAATCCTCGAGGATTATCTTCTTAAAGAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)