EMAIL THIS PAGE TO A FRIEND

KIAA1598

KIAA1598

121 Gene Product Result for
Gene ID:
chicken(771423) KIAA1598
domestic cat(101086007) KIAA1598 ortholog
dog(486905) KIAA1598 ortholog
cow(532603) KIAA1598 ortholog
sheep(101104358) KIAA1598 ortholog
domestic guinea pig(100720844) KIAA1598 ortholog
naked mole-rat(101711102) KIAA1598 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018330 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018330 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018330 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU075181 MISSION® esiRNA esiRNA human KIAA1598 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127211 Rosetta Predictions human pricing
NM_018330 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127211 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328782 predicted 1105
2 SASI_Hs02_00328783 predicted 715
3 SASI_Hs02_00328784 predicted 1190
4 SASI_Hs02_00328785 predicted 541
5 SASI_Hs02_00328786 predicted 570
6 SASI_Hs02_00328787 predicted 1014
7 SASI_Hs02_00328788 predicted 563
8 SASI_Hs02_00328789 predicted 999
9 SASI_Hs02_00328790 predicted 2408
10 SASI_Hs02_00328791 predicted 671
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018330 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025385 predicted 1105
2 SASI_Hs01_00025386 predicted 716
3 SASI_Hs01_00025387 predicted 1190
4 SASI_Hs01_00025388 predicted 532
5 SASI_Hs01_00025389 predicted 568
6 SASI_Hs01_00025390 predicted 1018
7 SASI_Hs01_00025391 predicted 554
8 SASI_Hs02_00351773 predicted 995
9 SASI_Hs01_00025394 predicted 671
10 SASI_Hs02_00351774 predicted 797
11 SASI_Hs01_00025392 predicted 909
12 SASI_Hs01_00025393 predicted 859
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018330
VALIDATED
KIAA1598 MISSION shRNA Bacterial Glycerol Stock
KIAA1598
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018330.3-1583s1c1
Sequence:CCGGCGAAGACAAAGCCAGAATCTTCTCGAGAAGATTCTGGCTTTGTCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_018330.3-730s1c1
Sequence:CCGGCGAGATCAAATTGTATCTGTTCTCGAGAACAGATACAATTTGATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018330.3-970s1c1
Sequence:CCGGCGAAAGAAAGCAGAGTCATTTCTCGAGAAATGACTCTGCTTTCTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018330.3-318s1c1
Sequence:CCGGGCAGCTCATTACCAGTCTGAACTCGAGTTCAGACTGGTAATGAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018330.3-1916s1c1
Sequence:CCGGGCACATGATTAGTGTTGTTATCTCGAGATAACAACACTAATCATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018330.5-550s21c1
Sequence:CCGGGAGCAAGCAATAGGCGAATATCTCGAGATATTCGCCTATTGCTTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018330.5-2126s21c1
Sequence:CCGGGCACATGATTAGTGTTGTTATCTCGAGATAACAACACTAATCATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_018330.5-528s21c1
Sequence:CCGGGCAGCTCATTACCAGTCTGAACTCGAGTTCAGACTGGTAATGAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_018330.5-628s21c1
Sequence:CCGGGAACGAGATGAAGCCGTTAAACTCGAGTTTAACGGCTTCATCTCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018330.5-1180s21c1
Sequence:CCGGCGAAAGAAAGCAGAGTCATTTCTCGAGAAATGACTCTGCTTTCTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018330
VALIDATED
KIAA1598 MISSION shRNA shRNA Plasmid DNA
KIAA1598
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018330.3-1583s1c1
Sequence:CCGGCGAAGACAAAGCCAGAATCTTCTCGAGAAGATTCTGGCTTTGTCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_018330.3-730s1c1
Sequence:CCGGCGAGATCAAATTGTATCTGTTCTCGAGAACAGATACAATTTGATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018330.3-970s1c1
Sequence:CCGGCGAAAGAAAGCAGAGTCATTTCTCGAGAAATGACTCTGCTTTCTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018330.3-318s1c1
Sequence:CCGGGCAGCTCATTACCAGTCTGAACTCGAGTTCAGACTGGTAATGAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018330.3-1916s1c1
Sequence:CCGGGCACATGATTAGTGTTGTTATCTCGAGATAACAACACTAATCATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018330.5-550s21c1
Sequence:CCGGGAGCAAGCAATAGGCGAATATCTCGAGATATTCGCCTATTGCTTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018330.5-2126s21c1
Sequence:CCGGGCACATGATTAGTGTTGTTATCTCGAGATAACAACACTAATCATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_018330.5-528s21c1
Sequence:CCGGGCAGCTCATTACCAGTCTGAACTCGAGTTCAGACTGGTAATGAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_018330.5-628s21c1
Sequence:CCGGGAACGAGATGAAGCCGTTAAACTCGAGTTTAACGGCTTCATCTCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018330.5-1180s21c1
Sequence:CCGGCGAAAGAAAGCAGAGTCATTTCTCGAGAAATGACTCTGCTTTCTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018330
VALIDATED
KIAA1598 MISSION shRNA Lentiviral Transduction Particles
KIAA1598
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018330.3-1583s1c1
Sequence:CCGGCGAAGACAAAGCCAGAATCTTCTCGAGAAGATTCTGGCTTTGTCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_018330.3-730s1c1
Sequence:CCGGCGAGATCAAATTGTATCTGTTCTCGAGAACAGATACAATTTGATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018330.3-970s1c1
Sequence:CCGGCGAAAGAAAGCAGAGTCATTTCTCGAGAAATGACTCTGCTTTCTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018330.3-318s1c1
Sequence:CCGGGCAGCTCATTACCAGTCTGAACTCGAGTTCAGACTGGTAATGAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018330.3-1916s1c1
Sequence:CCGGGCACATGATTAGTGTTGTTATCTCGAGATAACAACACTAATCATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018330.5-550s21c1
Sequence:CCGGGAGCAAGCAATAGGCGAATATCTCGAGATATTCGCCTATTGCTTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018330.5-2126s21c1
Sequence:CCGGGCACATGATTAGTGTTGTTATCTCGAGATAACAACACTAATCATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_018330.5-528s21c1
Sequence:CCGGGCAGCTCATTACCAGTCTGAACTCGAGTTCAGACTGGTAATGAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_018330.5-628s21c1
Sequence:CCGGGAACGAGATGAAGCCGTTAAACTCGAGTTTAACGGCTTCATCTCGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018330.5-1180s21c1
Sequence:CCGGCGAAAGAAAGCAGAGTCATTTCTCGAGAAATGACTCTGCTTTCTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)