EMAIL THIS PAGE TO A FRIEND

KIAA1614

KIAA1614

38 Gene Product Result for
Synonyms: RP11-46A10.3
UniProtKB ID: Q5VZ46, Q5VZ45, Q9HCF8
Gene ID:
chicken(424414) KIAA1614
cow(785141) KIAA1614 ortholog
domestic cat(101080679) KIAA1614 ortholog
dog(610416) KIAA1614 ortholog
sheep(101119922) KIAA1614 ortholog
domestic guinea pig(100713958) KIAA1614 ortholog
naked mole-rat(101698260) KIAA1614 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020950 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020950 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020950 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020950 Rosetta Predictions human pricing
XM_046531 Rosetta Predictions human pricing
XM_935436 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020950 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354366 predicted 2075
2 SASI_Hs02_00354367 predicted 2154
3 SASI_Hs02_00354368 predicted 1340
4 SASI_Hs02_00354369 predicted 2455
5 SASI_Hs02_00354370 predicted 1842
6 SASI_Hs02_00354371 predicted 1159
7 SASI_Hs02_00354372 predicted 2437
8 SASI_Hs02_00354373 predicted 3590
9 SASI_Hs02_00354374 predicted 2184
10 SASI_Hs02_00354375 predicted 2565
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_046531 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00291592 predicted 1222
2 SASI_Hs01_00291593 predicted 1305
3 SASI_Hs01_00291594 predicted 498
4 SASI_Hs01_00291595 predicted 1003
5 SASI_Hs01_00291596 predicted 1587
6 SASI_Hs01_00291597 predicted 2745
7 SASI_Hs01_00291598 predicted 1344
8 SASI_Hs01_00291599 predicted 1721
9 SASI_Hs01_00291600 predicted 1740
10 SASI_Hs01_00291601 predicted 1537
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935436 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00267219 predicted 968
2 SASI_Hs01_00267220 predicted 523
3 SASI_Hs01_00267221 predicted 1462
4 SASI_Hs01_00267222 predicted 977
5 SASI_Hs01_00267223 predicted 514
6 SASI_Hs01_00267224 predicted 527
7 SASI_Hs01_00267225 predicted 722
8 SASI_Hs01_00267226 predicted 228
9 SASI_Hs01_00267227 predicted 843
10 SASI_Hs01_00267228 predicted 420
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020950
KIAA1614 MISSION shRNA Bacterial Glycerol Stock
KIAA1614
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000283752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020950.1-3845s21c1
Sequence:CCGGGTCTGATGACATCTTGAAATTCTCGAGAATTTCAAGATGTCATCAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020950.1-979s21c1
Sequence:CCGGGCAGGAGATGCTCAACGTTTCCTCGAGGAAACGTTGAGCATCTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020950.1-2153s21c1
Sequence:CCGGACGCCTGAAGGAACTCTATTTCTCGAGAAATAGAGTTCCTTCAGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020950.1-1837s21c1
Sequence:CCGGCATGGAATGGATCCGGGAAACCTCGAGGTTTCCCGGATCCATTCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020950
KIAA1614 MISSION shRNA shRNA Plasmid DNA
KIAA1614
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000283752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020950.1-3845s21c1
Sequence:CCGGGTCTGATGACATCTTGAAATTCTCGAGAATTTCAAGATGTCATCAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020950.1-979s21c1
Sequence:CCGGGCAGGAGATGCTCAACGTTTCCTCGAGGAAACGTTGAGCATCTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020950.1-2153s21c1
Sequence:CCGGACGCCTGAAGGAACTCTATTTCTCGAGAAATAGAGTTCCTTCAGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020950.1-1837s21c1
Sequence:CCGGCATGGAATGGATCCGGGAAACCTCGAGGTTTCCCGGATCCATTCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020950
KIAA1614 MISSION shRNA Lentiviral Transduction Particles
KIAA1614
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000283752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020950.1-3845s21c1
Sequence:CCGGGTCTGATGACATCTTGAAATTCTCGAGAATTTCAAGATGTCATCAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020950.1-979s21c1
Sequence:CCGGGCAGGAGATGCTCAACGTTTCCTCGAGGAAACGTTGAGCATCTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020950.1-2153s21c1
Sequence:CCGGACGCCTGAAGGAACTCTATTTCTCGAGAAATAGAGTTCCTTCAGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020950.1-1837s21c1
Sequence:CCGGCATGGAATGGATCCGGGAAACCTCGAGGTTTCCCGGATCCATTCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)