EMAIL THIS PAGE TO A FRIEND

KIAA1644

KIAA1644

95 Gene Product Result for
UniProtKB ID: Q3SXP7, A6NHP0, A9Z1Z0, Q3SXP8, Q5JZ71, Q9BYB5
Gene ID:
domestic guinea pig(100727499) KIAA1644 ortholog
naked mole-rat(101706111) KIAA1644 ortholog
sheep(101107952) KIAA1644 ortholog
cow(789734) KIAA1644 ortholog
domestic cat(101093873) KIAA1644 ortholog
dog(100682848) KIAA1644 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001099294 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001099294 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001099294 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU145421 MISSION® esiRNA esiRNA human KIAA1644 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099294 Rosetta Predictions human pricing
XM_376018 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099294 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320459 predicted 887
2 SASI_Hs02_00320460 predicted 788
3 SASI_Hs02_00320461 predicted 428
4 SASI_Hs02_00320462 predicted 396
5 SASI_Hs02_00320463 predicted 697
6 SASI_Hs02_00320464 predicted 537
7 SASI_Hs02_00320465 predicted 202
8 SASI_Hs02_00320466 predicted 217
9 SASI_Hs02_00320467 predicted 235
10 SASI_Hs02_00320468 predicted 358
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_376018 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00281492 predicted 758
2 SASI_Hs01_00281493 predicted 274
3 SASI_Hs01_00281494 predicted 658
4 SASI_Hs01_00281495 predicted 821
5 SASI_Hs01_00281496 predicted 881
6 SASI_Hs01_00281497 predicted 912
7 SASI_Hs01_00281498 predicted 578
8 SASI_Hs01_00281499 predicted 268
9 SASI_Hs01_00281500 predicted 910
10 SASI_Hs01_00281501 predicted 271
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099294
KIAA1644 MISSION shRNA Bacterial Glycerol Stock
KIAA1644
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099294.1-197s21c1
Sequence:CCGGGCAGTCTTGTCTGCACATTTCCTCGAGGAAATGTGCAGACAAGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099294.1-399s21c1
Sequence:CCGGAGGGTTACATGCACAACAATTCTCGAGAATTGTTGTGCATGTAACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263376    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099294.1-6018s21c1
Sequence:CCGGTCACGACACTGTCCCATAAATCTCGAGATTTATGGGACAGTGTCGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099294.1-429s21c1
Sequence:CCGGTGTTGGGAGTGTGGATCTATGCTCGAGCATAGATCCACACTCCCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099294.1-318s21c1
Sequence:CCGGATAACAACACGGTCTTCAAATCTCGAGATTTGAAGACCGTGTTGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099294
KIAA1644 MISSION shRNA shRNA Plasmid DNA
KIAA1644
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099294.1-197s21c1
Sequence:CCGGGCAGTCTTGTCTGCACATTTCCTCGAGGAAATGTGCAGACAAGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099294.1-399s21c1
Sequence:CCGGAGGGTTACATGCACAACAATTCTCGAGAATTGTTGTGCATGTAACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263376    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099294.1-6018s21c1
Sequence:CCGGTCACGACACTGTCCCATAAATCTCGAGATTTATGGGACAGTGTCGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099294.1-429s21c1
Sequence:CCGGTGTTGGGAGTGTGGATCTATGCTCGAGCATAGATCCACACTCCCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099294.1-318s21c1
Sequence:CCGGATAACAACACGGTCTTCAAATCTCGAGATTTGAAGACCGTGTTGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099294
KIAA1644 MISSION shRNA Lentiviral Transduction Particles
KIAA1644
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099294.1-197s21c1
Sequence:CCGGGCAGTCTTGTCTGCACATTTCCTCGAGGAAATGTGCAGACAAGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099294.1-399s21c1
Sequence:CCGGAGGGTTACATGCACAACAATTCTCGAGAATTGTTGTGCATGTAACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263376    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099294.1-6018s21c1
Sequence:CCGGTCACGACACTGTCCCATAAATCTCGAGATTTATGGGACAGTGTCGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099294.1-429s21c1
Sequence:CCGGTGTTGGGAGTGTGGATCTATGCTCGAGCATAGATCCACACTCCCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099294.1-318s21c1
Sequence:CCGGATAACAACACGGTCTTCAAATCTCGAGATTTGAAGACCGTGTTGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)