EMAIL THIS PAGE TO A FRIEND

KIAA1671

KIAA1671

102 Gene Product Result for
UniProtKB ID: Q9BY89, B0QYF2, B7ZW08, Q5THZ5
Gene ID:
cow(533883) KIAA1671 ortholog
domestic cat(101090144) KIAA1671 ortholog
dog(611748) KIAA1671 ortholog
sheep(101117110) KIAA1671 ortholog
domestic guinea pig(100730231) KIAA1671 ortholog
naked mole-rat(101710045) KIAA1671 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA018135 Anti-KIAA1671 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145206 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145206 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145206 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_371461 Rosetta Predictions human pricing
XR_040421 Rosetta Predictions human pricing
XR_040422 Rosetta Predictions human pricing
XR_040423 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371461 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00264466 predicted 1236
2 SASI_Hs01_00264467 predicted 2108
3 SASI_Hs01_00264468 predicted 4666
4 SASI_Hs01_00264469 predicted 3141
5 SASI_Hs01_00264470 predicted 1723
6 SASI_Hs01_00264471 predicted 2182
7 SASI_Hs01_00264472 predicted 4006
8 SASI_Hs01_00264473 predicted 5272
9 SASI_Hs01_00264474 predicted 3375
10 SASI_Hs01_00264475 predicted 5017
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040421 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518711 predicted 1403
2 SASI_Hs02_00518712 predicted 2285
3 SASI_Hs02_00518713 predicted 4196
4 SASI_Hs02_00518714 predicted 3321
5 SASI_Hs02_00518715 predicted 3388
6 SASI_Hs02_00518716 predicted 1896
7 SASI_Hs02_00518717 predicted 2359
8 SASI_Hs02_00518718 predicted 4176
9 SASI_Hs02_00518719 predicted 3544
10 SASI_Hs02_00518720 predicted 2281
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040422 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518721 predicted 1411
2 SASI_Hs02_00518722 predicted 2281
3 SASI_Hs02_00518723 predicted 4197
4 SASI_Hs02_00518724 predicted 3322
5 SASI_Hs02_00518725 predicted 3387
6 SASI_Hs02_00518726 predicted 1894
7 SASI_Hs02_00518727 predicted 2355
8 SASI_Hs02_00518728 predicted 4173
9 SASI_Hs02_00518729 predicted 3546
10 SASI_Hs02_00518730 predicted 2280
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040423 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518731 predicted 1408
2 SASI_Hs02_00518732 predicted 2290
3 SASI_Hs02_00518733 predicted 4203
4 SASI_Hs02_00518734 predicted 3322
5 SASI_Hs02_00518735 predicted 3383
6 SASI_Hs02_00518736 predicted 1902
7 SASI_Hs02_00518737 predicted 2353
8 SASI_Hs02_00518738 predicted 4182
9 SASI_Hs02_00518739 predicted 3549
10 SASI_Hs02_00518740 predicted 2283
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145206
VALIDATED
KIAA1671 MISSION shRNA Bacterial Glycerol Stock
KIAA1671
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145206.1-5205s21c1
Sequence:CCGGATGGATCCGGCAGTGCTAAAGCTCGAGCTTTAGCACTGCCGGATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001145206.1-4910s21c1
Sequence:CCGGCTTCTCCTTCATTGATCAAACCTCGAGGTTTGATCAATGAAGGAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145206.1-5071s21c1
Sequence:CCGGACAACACGTGGATGTTCAAAGCTCGAGCTTTGAACATCCACGTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336634    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145206.1-5927s21c1
Sequence:CCGGTAGTCTCGGTGCAGGGTATTACTCGAGTAATACCCTGCACCGAGACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001145206.1-5411s21c1
Sequence:CCGGCAAGAAGAGGCAAAGTCTTTACTCGAGTAAAGACTTTGCCTCTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145206
VALIDATED
KIAA1671 MISSION shRNA shRNA Plasmid DNA
KIAA1671
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145206.1-5205s21c1
Sequence:CCGGATGGATCCGGCAGTGCTAAAGCTCGAGCTTTAGCACTGCCGGATCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001145206.1-4910s21c1
Sequence:CCGGCTTCTCCTTCATTGATCAAACCTCGAGGTTTGATCAATGAAGGAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145206.1-5071s21c1
Sequence:CCGGACAACACGTGGATGTTCAAAGCTCGAGCTTTGAACATCCACGTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336634    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145206.1-5927s21c1
Sequence:CCGGTAGTCTCGGTGCAGGGTATTACTCGAGTAATACCCTGCACCGAGACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001145206.1-5411s21c1
Sequence:CCGGCAAGAAGAGGCAAAGTCTTTACTCGAGTAAAGACTTTGCCTCTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145206
VALIDATED
KIAA1671 MISSION shRNA Lentiviral Transduction Particles
KIAA1671
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145206.1-5205s21c1
Sequence:CCGGATGGATCCGGCAGTGCTAAAGCTCGAGCTTTAGCACTGCCGGATCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001145206.1-4910s21c1
Sequence:CCGGCTTCTCCTTCATTGATCAAACCTCGAGGTTTGATCAATGAAGGAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145206.1-5071s21c1
Sequence:CCGGACAACACGTGGATGTTCAAAGCTCGAGCTTTGAACATCCACGTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336634    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145206.1-5927s21c1
Sequence:CCGGTAGTCTCGGTGCAGGGTATTACTCGAGTAATACCCTGCACCGAGACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001145206.1-5411s21c1
Sequence:CCGGCAAGAAGAGGCAAAGTCTTTACTCGAGTAAAGACTTTGCCTCTTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)