EMAIL THIS PAGE TO A FRIEND

KIAA1683

KIAA1683

18 Gene Product Result for
Gene ID:
sheep(101111020) KIAA1683 ortholog
dog(484825) KIAA1683 ortholog
domestic cat(101094329) KIAA1683 ortholog
cow(788637) KIAA1683 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025249 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025249 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025249 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU158991 MISSION® esiRNA esiRNA human KIAA1683 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025249 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025249 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043089 predicted 3536
2 SASI_Hs01_00043090 predicted 958
3 SASI_Hs01_00043092 predicted 974
4 SASI_Hs01_00043093 predicted 2449
5 SASI_Hs01_00043094 predicted 2276
6 SASI_Hs01_00043095 predicted 1920
7 SASI_Hs01_00043096 predicted 474
8 SASI_Hs01_00043097 predicted 1152
9 SASI_Hs01_00043098 predicted 972
10 SASI_Hs02_00358082 predicted 2211
11 SASI_Hs01_00043091 predicted 1042
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025249
KIAA1683 MISSION shRNA Bacterial Glycerol Stock
KIAA1683
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025249.1-3511s1c1
Sequence:CCGGCTTTAAGATCCGCCAGCAGATCTCGAGATCTGCTGGCGGATCTTAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181133    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025249.1-3552s1c1
Sequence:CCGGCGAAGATAGTTCAAGCCACCTCTCGAGAGGTGGCTTGAACTATCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025249.1-2071s1c1
Sequence:CCGGCGTGTATGTGCCTGTAGACATCTCGAGATGTCTACAGGCACATACACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025249.1-2991s1c1
Sequence:CCGGCCATGGTCATCCAAGCTACTTCTCGAGAAGTAGCTTGGATGACCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025249.1-1130s1c1
Sequence:CCGGCCCATGATCACCAAGACTCTACTCGAGTAGAGTCTTGGTGATCATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025249
KIAA1683 MISSION shRNA shRNA Plasmid DNA
KIAA1683
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025249.1-3511s1c1
Sequence:CCGGCTTTAAGATCCGCCAGCAGATCTCGAGATCTGCTGGCGGATCTTAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181133    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025249.1-3552s1c1
Sequence:CCGGCGAAGATAGTTCAAGCCACCTCTCGAGAGGTGGCTTGAACTATCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025249.1-2071s1c1
Sequence:CCGGCGTGTATGTGCCTGTAGACATCTCGAGATGTCTACAGGCACATACACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025249.1-2991s1c1
Sequence:CCGGCCATGGTCATCCAAGCTACTTCTCGAGAAGTAGCTTGGATGACCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025249.1-1130s1c1
Sequence:CCGGCCCATGATCACCAAGACTCTACTCGAGTAGAGTCTTGGTGATCATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025249
KIAA1683 MISSION shRNA Lentiviral Transduction Particles
KIAA1683
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025249.1-3511s1c1
Sequence:CCGGCTTTAAGATCCGCCAGCAGATCTCGAGATCTGCTGGCGGATCTTAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181133    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025249.1-3552s1c1
Sequence:CCGGCGAAGATAGTTCAAGCCACCTCTCGAGAGGTGGCTTGAACTATCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025249.1-2071s1c1
Sequence:CCGGCGTGTATGTGCCTGTAGACATCTCGAGATGTCTACAGGCACATACACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025249.1-2991s1c1
Sequence:CCGGCCATGGTCATCCAAGCTACTTCTCGAGAAGTAGCTTGGATGACCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025249.1-1130s1c1
Sequence:CCGGCCCATGATCACCAAGACTCTACTCGAGTAGAGTCTTGGTGATCATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)