EMAIL THIS PAGE TO A FRIEND

KIAA1715

KIAA1715

38 Gene Product Result for
Synonyms: LNP Ul ulnaless
Gene ID:
domestic guinea pig(100724426) KIAA1715 ortholog
naked mole-rat(101718841) KIAA1715 ortholog
sheep(101107574) KIAA1715 ortholog
chicken(424141) KIAA1715
cow(533298) KIAA1715
domestic cat(101097507) KIAA1715 ortholog
dog(478809) KIAA1715 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA014205 Anti-LNPK antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030650 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030650 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030650 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU051511 MISSION® esiRNA esiRNA human KIAA1715 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030650 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030650 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106448 predicted 1313
2 SASI_Hs01_00106449 predicted 1007
3 SASI_Hs01_00106450 predicted 1494
4 SASI_Hs01_00106452 predicted 454
5 SASI_Hs01_00106453 predicted 586
6 SASI_Hs01_00106454 predicted 352
7 SASI_Hs01_00106455 predicted 1394
8 SASI_Hs01_00106456 predicted 997
9 SASI_Hs02_00358229 predicted 822
10 SASI_Hs01_00106457 predicted 269
11 SASI_Hs01_00106451 predicted 1231
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030650
VALIDATED
KIAA1715 MISSION shRNA Bacterial Glycerol Stock
KIAA1715
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000279674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030650.1-1465s21c1
Sequence:CCGGTTTGACGGCAGAGTAGTAAATCTCGAGATTTACTACTCTGCCGTCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_030650.1-1316s21c1
Sequence:CCGGCAGACAAACCAAGTGATTGAACTCGAGTTCAATCACTTGGTTTGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_030650.1-572s1c1
Sequence:CCGGGAAACTTACAAGACGGCTAAACTCGAGTTTAGCCGTCTTGTAAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030650.1-1445s1c1
Sequence:CCGGCCTGAACTAAGTGGAGAATCTCTCGAGAGATTCTCCACTTAGTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_030650.1-1316s1c1
Sequence:CCGGCAGACAAACCAAGTGATTGAACTCGAGTTCAATCACTTGGTTTGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030650.1-454s1c1
Sequence:CCGGCTGGAGCATAAGAACAGTAATCTCGAGATTACTGTTCTTATGCTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030650.1-1219s1c1
Sequence:CCGGGCTTTCATCAGACAACCAGTTCTCGAGAACTGGTTGTCTGATGAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128745    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_030650.1-1493s1c1
Sequence:CCGGCGTGCCTTCAACTGGATATTTCTCGAGAAATATCCAGTTGAAGGCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_030650.1-572s21c1
Sequence:CCGGGAAACTTACAAGACGGCTAAACTCGAGTTTAGCCGTCTTGTAAGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_030650.1-1260s21c1
Sequence:CCGGACGATGTTCTTGATGATAATACTCGAGTATTATCATCAAGAACATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030650.1-1783s21c1
Sequence:CCGGGTATGTATAACCCGTAAATATCTCGAGATATTTACGGGTTATACATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030650
VALIDATED
KIAA1715 MISSION shRNA shRNA Plasmid DNA
KIAA1715
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000279674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030650.1-1465s21c1
Sequence:CCGGTTTGACGGCAGAGTAGTAAATCTCGAGATTTACTACTCTGCCGTCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_030650.1-1316s21c1
Sequence:CCGGCAGACAAACCAAGTGATTGAACTCGAGTTCAATCACTTGGTTTGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_030650.1-572s1c1
Sequence:CCGGGAAACTTACAAGACGGCTAAACTCGAGTTTAGCCGTCTTGTAAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030650.1-1445s1c1
Sequence:CCGGCCTGAACTAAGTGGAGAATCTCTCGAGAGATTCTCCACTTAGTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_030650.1-1316s1c1
Sequence:CCGGCAGACAAACCAAGTGATTGAACTCGAGTTCAATCACTTGGTTTGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030650.1-454s1c1
Sequence:CCGGCTGGAGCATAAGAACAGTAATCTCGAGATTACTGTTCTTATGCTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030650.1-1219s1c1
Sequence:CCGGGCTTTCATCAGACAACCAGTTCTCGAGAACTGGTTGTCTGATGAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128745    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_030650.1-1493s1c1
Sequence:CCGGCGTGCCTTCAACTGGATATTTCTCGAGAAATATCCAGTTGAAGGCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_030650.1-572s21c1
Sequence:CCGGGAAACTTACAAGACGGCTAAACTCGAGTTTAGCCGTCTTGTAAGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_030650.1-1260s21c1
Sequence:CCGGACGATGTTCTTGATGATAATACTCGAGTATTATCATCAAGAACATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030650.1-1783s21c1
Sequence:CCGGGTATGTATAACCCGTAAATATCTCGAGATATTTACGGGTTATACATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030650
VALIDATED
KIAA1715 MISSION shRNA Lentiviral Transduction Particles
KIAA1715
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000279674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030650.1-1465s21c1
Sequence:CCGGTTTGACGGCAGAGTAGTAAATCTCGAGATTTACTACTCTGCCGTCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_030650.1-1316s21c1
Sequence:CCGGCAGACAAACCAAGTGATTGAACTCGAGTTCAATCACTTGGTTTGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_030650.1-572s1c1
Sequence:CCGGGAAACTTACAAGACGGCTAAACTCGAGTTTAGCCGTCTTGTAAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030650.1-1445s1c1
Sequence:CCGGCCTGAACTAAGTGGAGAATCTCTCGAGAGATTCTCCACTTAGTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_030650.1-1316s1c1
Sequence:CCGGCAGACAAACCAAGTGATTGAACTCGAGTTCAATCACTTGGTTTGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030650.1-454s1c1
Sequence:CCGGCTGGAGCATAAGAACAGTAATCTCGAGATTACTGTTCTTATGCTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030650.1-1219s1c1
Sequence:CCGGGCTTTCATCAGACAACCAGTTCTCGAGAACTGGTTGTCTGATGAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128745    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_030650.1-1493s1c1
Sequence:CCGGCGTGCCTTCAACTGGATATTTCTCGAGAAATATCCAGTTGAAGGCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_030650.1-572s21c1
Sequence:CCGGGAAACTTACAAGACGGCTAAACTCGAGTTTAGCCGTCTTGTAAGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_030650.1-1260s21c1
Sequence:CCGGACGATGTTCTTGATGATAATACTCGAGTATTATCATCAAGAACATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030650.1-1783s21c1
Sequence:CCGGGTATGTATAACCCGTAAATATCTCGAGATATTTACGGGTTATACATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)