EMAIL THIS PAGE TO A FRIEND

KIAA1731

KIAA1731

20 Gene Product Result for
Gene ID:
chicken(419003) KIAA1731 ortholog
dog(100683524) KIAA1731 ortholog
cow(532848) KIAA1731 ortholog
domestic cat(101083200) KIAA1731 ortholog
sheep(101106980) KIAA1731 ortholog
domestic guinea pig(100722711) KIAA1731 ortholog
naked mole-rat(101703183) KIAA1731 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033395 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033395 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033395 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033395 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033395 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361263 predicted 5385
2 SASI_Hs02_00361264 predicted 2357
3 SASI_Hs02_00361265 predicted 2300
4 SASI_Hs02_00361266 predicted 2222
5 SASI_Hs02_00361267 predicted 6889
6 SASI_Hs02_00361268 predicted 241
7 SASI_Hs02_00361269 predicted 2814
8 SASI_Hs02_00361270 predicted 6208
9 SASI_Hs02_00361271 predicted 4075
10 SASI_Hs02_00361272 predicted 3254
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033395
KIAA1731 MISSION shRNA Bacterial Glycerol Stock
KIAA1731
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000336906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033395.1-1493s21c1
Sequence:CCGGGAAAGTGATACACTAACAATTCTCGAGAATTGTTAGTGTATCACTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033395.1-2303s21c1
Sequence:CCGGACACAACAGAGAGACTATAAACTCGAGTTTATAGTCTCTCTGTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033395.1-5743s21c1
Sequence:CCGGACTAGGTAAACCAGGTATTTACTCGAGTAAATACCTGGTTTACCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033395.1-2364s21c1
Sequence:CCGGCACATGACAGGCAGCTAATATCTCGAGATATTAGCTGCCTGTCATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033395.1-7731s21c1
Sequence:CCGGGTCGTCTAAAGGGCGTGAATACTCGAGTATTCACGCCCTTTAGACGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033395
KIAA1731 MISSION shRNA shRNA Plasmid DNA
KIAA1731
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000336906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033395.1-1493s21c1
Sequence:CCGGGAAAGTGATACACTAACAATTCTCGAGAATTGTTAGTGTATCACTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033395.1-2303s21c1
Sequence:CCGGACACAACAGAGAGACTATAAACTCGAGTTTATAGTCTCTCTGTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033395.1-5743s21c1
Sequence:CCGGACTAGGTAAACCAGGTATTTACTCGAGTAAATACCTGGTTTACCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033395.1-2364s21c1
Sequence:CCGGCACATGACAGGCAGCTAATATCTCGAGATATTAGCTGCCTGTCATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033395.1-7731s21c1
Sequence:CCGGGTCGTCTAAAGGGCGTGAATACTCGAGTATTCACGCCCTTTAGACGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033395
KIAA1731 MISSION shRNA Lentiviral Transduction Particles
KIAA1731
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000336906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033395.1-1493s21c1
Sequence:CCGGGAAAGTGATACACTAACAATTCTCGAGAATTGTTAGTGTATCACTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033395.1-2303s21c1
Sequence:CCGGACACAACAGAGAGACTATAAACTCGAGTTTATAGTCTCTCTGTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033395.1-5743s21c1
Sequence:CCGGACTAGGTAAACCAGGTATTTACTCGAGTAAATACCTGGTTTACCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033395.1-2364s21c1
Sequence:CCGGCACATGACAGGCAGCTAATATCTCGAGATATTAGCTGCCTGTCATGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033395.1-7731s21c1
Sequence:CCGGGTCGTCTAAAGGGCGTGAATACTCGAGTATTCACGCCCTTTAGACGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)