EMAIL THIS PAGE TO A FRIEND

KIAA1737

KIAA1737

140 Gene Product Result for
UniProtKB ID: Q9C0C6, B2RCI1, Q8N389, Q8NDZ1
Gene ID:
domestic guinea pig(100717106) KIAA1737 ortholog
naked mole-rat(101708943) KIAA1737 ortholog
chicken(771996) KIAA1737
dog(490802) KIAA1737 ortholog
cow(506130) KIAA1737 ortholog
domestic cat(101100395) KIAA1737 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA000644 Anti-CIPC antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033426 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033426 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033426 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU101131 MISSION® esiRNA esiRNA human KIAA1737 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033426 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033426 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182102 predicted 1353
2 SASI_Hs01_00182103 predicted 1371
3 SASI_Hs01_00182104 predicted 1363
4 SASI_Hs01_00182105 predicted 1366
5 SASI_Hs01_00182106 predicted 1391
6 SASI_Hs01_00182107 predicted 621
7 SASI_Hs01_00182108 predicted 1199
8 SASI_Hs01_00182109 predicted 1234
9 SASI_Hs01_00182110 predicted 1479
10 SASI_Hs01_00182111 predicted 1157
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033426
VALIDATED
KIAA1737 MISSION shRNA Bacterial Glycerol Stock
KIAA1737
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_033426.2-1315s21c1
Sequence:CCGGTAACACCTGGGTCCAGTAATACTCGAGTATTACTGGACCCAGGTGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033426.2-2529s1c1
Sequence:CCGGCCAGAGGTGTAATGTTGGTTACTCGAGTAACCAACATTACACCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033426.2-549s1c1
Sequence:CCGGCAGCCACAGCTCTTATTCCTTCTCGAGAAGGAATAAGAGCTGTGGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_033426.2-1024s21c1
Sequence:CCGGTTTCACCACTGTCCGCTAATTCTCGAGAATTAGCGGACAGTGGTGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_033426.2-1136s21c1
Sequence:CCGGTACCCTAGTAGTCCTACATAACTCGAGTTATGTAGGACTACTAGGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263285    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_033426.2-3920s21c1
Sequence:CCGGTTAGCGATGAATAACGTAATTCTCGAGAATTACGTTATTCATCGCTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_033426.2-1374s21c1
Sequence:CCGGATATAGCACAGAGGCATATTTCTCGAGAAATATGCCTCTGTGCTATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033426
VALIDATED
KIAA1737 MISSION shRNA shRNA Plasmid DNA
KIAA1737
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_033426.2-1315s21c1
Sequence:CCGGTAACACCTGGGTCCAGTAATACTCGAGTATTACTGGACCCAGGTGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033426.2-2529s1c1
Sequence:CCGGCCAGAGGTGTAATGTTGGTTACTCGAGTAACCAACATTACACCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033426.2-549s1c1
Sequence:CCGGCAGCCACAGCTCTTATTCCTTCTCGAGAAGGAATAAGAGCTGTGGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_033426.2-1024s21c1
Sequence:CCGGTTTCACCACTGTCCGCTAATTCTCGAGAATTAGCGGACAGTGGTGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_033426.2-1136s21c1
Sequence:CCGGTACCCTAGTAGTCCTACATAACTCGAGTTATGTAGGACTACTAGGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263285    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_033426.2-3920s21c1
Sequence:CCGGTTAGCGATGAATAACGTAATTCTCGAGAATTACGTTATTCATCGCTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_033426.2-1374s21c1
Sequence:CCGGATATAGCACAGAGGCATATTTCTCGAGAAATATGCCTCTGTGCTATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033426
VALIDATED
KIAA1737 MISSION shRNA Lentiviral Transduction Particles
KIAA1737
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_033426.2-1315s21c1
Sequence:CCGGTAACACCTGGGTCCAGTAATACTCGAGTATTACTGGACCCAGGTGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033426.2-2529s1c1
Sequence:CCGGCCAGAGGTGTAATGTTGGTTACTCGAGTAACCAACATTACACCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033426.2-549s1c1
Sequence:CCGGCAGCCACAGCTCTTATTCCTTCTCGAGAAGGAATAAGAGCTGTGGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_033426.2-1024s21c1
Sequence:CCGGTTTCACCACTGTCCGCTAATTCTCGAGAATTAGCGGACAGTGGTGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_033426.2-1136s21c1
Sequence:CCGGTACCCTAGTAGTCCTACATAACTCGAGTTATGTAGGACTACTAGGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263285    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_033426.2-3920s21c1
Sequence:CCGGTTAGCGATGAATAACGTAATTCTCGAGAATTACGTTATTCATCGCTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_033426.2-1374s21c1
Sequence:CCGGATATAGCACAGAGGCATATTTCTCGAGAAATATGCCTCTGTGCTATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)