EMAIL THIS PAGE TO A FRIEND

KIAA1751

KIAA1751

48 Gene Product Result for
UniProtKB ID: Q9C0B2, A4VCI2, Q5T2D9, Q5T2E0, Q6ZSJ4
Gene ID:
chicken(419400) KIAA1751
dog(607323) KIAA1751 ortholog
cow(617386) KIAA1751 ortholog
sheep(101122804) KIAA1751 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080484 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080484 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080484 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU145231 MISSION® esiRNA esiRNA human KIAA1751 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080484 Rosetta Predictions human pricing
XM_372193 Rosetta Predictions human pricing
XM_933934 Rosetta Predictions human pricing
XM_933936 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080484 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315286 predicted 374
2 SASI_Hs02_00315287 predicted 310
3 SASI_Hs02_00315288 predicted 1343
4 SASI_Hs02_00315289 predicted 1830
5 SASI_Hs02_00315290 predicted 1901
6 SASI_Hs02_00315291 predicted 2447
7 SASI_Hs02_00315292 predicted 1914
8 SASI_Hs02_00315293 predicted 1324
9 SASI_Hs02_00315294 predicted 1445
10 SASI_Hs02_00315295 predicted 2136
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_372193 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00270776 predicted 1400
2 SASI_Hs01_00270777 predicted 1012
3 SASI_Hs01_00270778 predicted 1496
4 SASI_Hs01_00270779 predicted 1574
5 SASI_Hs01_00270780 predicted 2121
6 SASI_Hs01_00270781 predicted 1578
7 SASI_Hs01_00270782 predicted 1012
8 SASI_Hs01_00270783 predicted 1000
9 SASI_Hs01_00270784 predicted 1108
10 SASI_Hs01_00270785 predicted 652
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933934 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00281532 predicted 403
2 SASI_Hs01_00281533 predicted 400
3 SASI_Hs01_00281534 predicted 399
4 SASI_Hs01_00281535 predicted 260
5 SASI_Hs01_00281536 predicted 202
6 SASI_Hs01_00281537 predicted 400
7 SASI_Hs01_00281538 predicted 462
8 SASI_Hs01_00281539 predicted 288
9 SASI_Hs01_00281540 predicted 244
10 SASI_Hs01_00281541 predicted 355
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933936 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00266255 predicted 857
2 SASI_Hs01_00266256 predicted 291
3 SASI_Hs01_00266257 predicted 307
4 SASI_Hs01_00266258 predicted 1063
5 SASI_Hs01_00266259 predicted 362
6 SASI_Hs01_00266260 predicted 873
7 SASI_Hs01_00266261 predicted 746
8 SASI_Hs01_00266262 predicted 763
9 SASI_Hs01_00266263 predicted 607
10 SASI_Hs01_00266264 predicted 317
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080484
KIAA1751 MISSION shRNA Bacterial Glycerol Stock
KIAA1751
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080484.1-242s21c1
Sequence:CCGGATCCGGAGTTTGACATCAAATCTCGAGATTTGATGTCAAACTCCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080484.1-1901s21c1
Sequence:CCGGTCACCTTCAAGCCGATGATAACTCGAGTTATCATCGGCTTGAAGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080484.1-1930s21c1
Sequence:CCGGCTAGAAGGAAATATCTCATTTCTCGAGAAATGAGATATTTCCTTCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263326    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080484.1-3605s21c1
Sequence:CCGGACTGCCACATCTGGCTATTTACTCGAGTAAATAGCCAGATGTGGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080484.1-2178s21c1
Sequence:CCGGTCTCCTGACCTACGAAGATAACTCGAGTTATCTTCGTAGGTCAGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080484
KIAA1751 MISSION shRNA shRNA Plasmid DNA
KIAA1751
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080484.1-242s21c1
Sequence:CCGGATCCGGAGTTTGACATCAAATCTCGAGATTTGATGTCAAACTCCGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080484.1-1901s21c1
Sequence:CCGGTCACCTTCAAGCCGATGATAACTCGAGTTATCATCGGCTTGAAGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080484.1-1930s21c1
Sequence:CCGGCTAGAAGGAAATATCTCATTTCTCGAGAAATGAGATATTTCCTTCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263326    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080484.1-3605s21c1
Sequence:CCGGACTGCCACATCTGGCTATTTACTCGAGTAAATAGCCAGATGTGGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080484.1-2178s21c1
Sequence:CCGGTCTCCTGACCTACGAAGATAACTCGAGTTATCTTCGTAGGTCAGGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080484
KIAA1751 MISSION shRNA Lentiviral Transduction Particles
KIAA1751
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080484.1-242s21c1
Sequence:CCGGATCCGGAGTTTGACATCAAATCTCGAGATTTGATGTCAAACTCCGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080484.1-1901s21c1
Sequence:CCGGTCACCTTCAAGCCGATGATAACTCGAGTTATCATCGGCTTGAAGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080484.1-1930s21c1
Sequence:CCGGCTAGAAGGAAATATCTCATTTCTCGAGAAATGAGATATTTCCTTCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263326    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080484.1-3605s21c1
Sequence:CCGGACTGCCACATCTGGCTATTTACTCGAGTAAATAGCCAGATGTGGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080484.1-2178s21c1
Sequence:CCGGTCTCCTGACCTACGAAGATAACTCGAGTTATCTTCGTAGGTCAGGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)