EMAIL THIS PAGE TO A FRIEND

KIAA1755

KIAA1755

87 Gene Product Result for
UniProtKB ID: Q5JYT7, Q9C0A8
Gene ID:
sheep(101123397) KIAA1755 ortholog
domestic guinea pig(100713460) KIAA1755 ortholog
naked mole-rat(101698731) KIAA1755 ortholog
chicken(419294) KIAA1755 ortholog
chicken(101669297) KIAA1755 ortholog
chicken(101750666) KIAA1755 ortholog
cow(514211) KIAA1755 ortholog
domestic cat(101094918) KIAA1755 ortholog
dog(485868) KIAA1755 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001029864 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001029864 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001029864 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU030931 MISSION® esiRNA esiRNA human KIAA1755 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001029864 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029864 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130646 predicted 962
2 SASI_Hs01_00130647 predicted 1590
3 SASI_Hs01_00130648 predicted 990
4 SASI_Hs01_00130649 predicted 1085
5 SASI_Hs01_00130650 predicted 2249
6 SASI_Hs01_00130651 predicted 2665
7 SASI_Hs01_00130652 predicted 2706
8 SASI_Hs01_00130653 predicted 3288
9 SASI_Hs01_00130654 predicted 3282
10 SASI_Hs01_00130655 predicted 1199
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029864
KIAA1755 MISSION shRNA Bacterial Glycerol Stock
KIAA1755
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000141042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029864.1-2915s1c1
Sequence:CCGGCCACGCAGAATTTGAGAACTTCTCGAGAAGTTCTCAAATTCTGCGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029864.1-1479s1c1
Sequence:CCGGCCTCTAGGAAACCCAGAGAATCTCGAGATTCTCTGGGTTTCCTAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140544    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029864.1-5690s1c1
Sequence:CCGGGCCAAGAGTCACACACTTGATCTCGAGATCAAGTGTGTGACTCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029864.1-1789s1c1
Sequence:CCGGCTAAACCCAACCGAGCCAAATCTCGAGATTTGGCTCGGTTGGGTTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029864.1-809s1c1
Sequence:CCGGCAAGATAACCAGCCCAGAGTTCTCGAGAACTCTGGGCTGGTTATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029864.1-629s1c1
Sequence:CCGGCATGATCAAATGCCTCTCCCTCTCGAGAGGGAGAGGCATTTGATCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029864.1-404s1c1
Sequence:CCGGGCTGAGCTTCCTTCTGGATTTCTCGAGAAATCCAGAAGGAAGCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029864.1-998s1c1
Sequence:CCGGGAGCAAGTATCCAGGACTCATCTCGAGATGAGTCCTGGATACTTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029864.1-3568s1c1
Sequence:CCGGGCATGGACCATTTGCCAAAGTCTCGAGACTTTGGCAAATGGTCCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029864.1-1201s1c1
Sequence:CCGGGAACTAAGGAAACTCCCTTATCTCGAGATAAGGGAGTTTCCTTAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144285    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001029864.1-4406s1c1
Sequence:CCGGCGAATCTGCAAAGGGAATAAACTCGAGTTTATTCCCTTTGCAGATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029864.1-1328s1c1
Sequence:CCGGCAGGAGAAAGGTCAATCTTAACTCGAGTTAAGATTGACCTTTCTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029864
KIAA1755 MISSION shRNA shRNA Plasmid DNA
KIAA1755
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000141042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029864.1-2915s1c1
Sequence:CCGGCCACGCAGAATTTGAGAACTTCTCGAGAAGTTCTCAAATTCTGCGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029864.1-1479s1c1
Sequence:CCGGCCTCTAGGAAACCCAGAGAATCTCGAGATTCTCTGGGTTTCCTAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140544    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029864.1-5690s1c1
Sequence:CCGGGCCAAGAGTCACACACTTGATCTCGAGATCAAGTGTGTGACTCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029864.1-1789s1c1
Sequence:CCGGCTAAACCCAACCGAGCCAAATCTCGAGATTTGGCTCGGTTGGGTTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029864.1-809s1c1
Sequence:CCGGCAAGATAACCAGCCCAGAGTTCTCGAGAACTCTGGGCTGGTTATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029864.1-629s1c1
Sequence:CCGGCATGATCAAATGCCTCTCCCTCTCGAGAGGGAGAGGCATTTGATCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029864.1-404s1c1
Sequence:CCGGGCTGAGCTTCCTTCTGGATTTCTCGAGAAATCCAGAAGGAAGCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029864.1-998s1c1
Sequence:CCGGGAGCAAGTATCCAGGACTCATCTCGAGATGAGTCCTGGATACTTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029864.1-3568s1c1
Sequence:CCGGGCATGGACCATTTGCCAAAGTCTCGAGACTTTGGCAAATGGTCCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029864.1-1201s1c1
Sequence:CCGGGAACTAAGGAAACTCCCTTATCTCGAGATAAGGGAGTTTCCTTAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144285    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001029864.1-4406s1c1
Sequence:CCGGCGAATCTGCAAAGGGAATAAACTCGAGTTTATTCCCTTTGCAGATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029864.1-1328s1c1
Sequence:CCGGCAGGAGAAAGGTCAATCTTAACTCGAGTTAAGATTGACCTTTCTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029864
KIAA1755 MISSION shRNA Lentiviral Transduction Particles
KIAA1755
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000141042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029864.1-2915s1c1
Sequence:CCGGCCACGCAGAATTTGAGAACTTCTCGAGAAGTTCTCAAATTCTGCGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029864.1-1479s1c1
Sequence:CCGGCCTCTAGGAAACCCAGAGAATCTCGAGATTCTCTGGGTTTCCTAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140544    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029864.1-5690s1c1
Sequence:CCGGGCCAAGAGTCACACACTTGATCTCGAGATCAAGTGTGTGACTCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029864.1-1789s1c1
Sequence:CCGGCTAAACCCAACCGAGCCAAATCTCGAGATTTGGCTCGGTTGGGTTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029864.1-809s1c1
Sequence:CCGGCAAGATAACCAGCCCAGAGTTCTCGAGAACTCTGGGCTGGTTATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029864.1-629s1c1
Sequence:CCGGCATGATCAAATGCCTCTCCCTCTCGAGAGGGAGAGGCATTTGATCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029864.1-404s1c1
Sequence:CCGGGCTGAGCTTCCTTCTGGATTTCTCGAGAAATCCAGAAGGAAGCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029864.1-998s1c1
Sequence:CCGGGAGCAAGTATCCAGGACTCATCTCGAGATGAGTCCTGGATACTTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029864.1-3568s1c1
Sequence:CCGGGCATGGACCATTTGCCAAAGTCTCGAGACTTTGGCAAATGGTCCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029864.1-1201s1c1
Sequence:CCGGGAACTAAGGAAACTCCCTTATCTCGAGATAAGGGAGTTTCCTTAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144285    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001029864.1-4406s1c1
Sequence:CCGGCGAATCTGCAAAGGGAATAAACTCGAGTTTATTCCCTTTGCAGATTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029864.1-1328s1c1
Sequence:CCGGCAGGAGAAAGGTCAATCTTAACTCGAGTTAAGATTGACCTTTCTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)