EMAIL THIS PAGE TO A FRIEND

KIAA1804

53 Gene Product Result for
Synonyms: MLK4 RP5-862P8.2 dJ862P8.3
Gene ID:
dog(100688368) mixed lineage kinase 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032435 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032435 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032435 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU005501 MISSION® esiRNA esiRNA targeting human MAP3K19 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032435 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032435 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359840 predicted 3426
2 SASI_Hs01_00092367 predicted 3372
3 SASI_Hs01_00092368 predicted 1398
4 SASI_Hs01_00092369 predicted 3346
5 SASI_Hs01_00092370 predicted 1757
6 SASI_Hs01_00092372 predicted 2250
7 SASI_Hs01_00092373 predicted 1340
8 SASI_Hs02_00359841 predicted 2747
9 SASI_Hs01_00092374 predicted 3373
10 SASI_Hs02_00359842 predicted 2908
11 SASI_Hs01_00092371 predicted 2899
12 SASI_Hs01_00092375 predicted 1511
13 SASI_Hs01_00092376 predicted 3368
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032435
VALIDATED
KIAA1804 MISSION shRNA Bacterial Glycerol Stock
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_032435.x-2971s1c1
Sequence:CCGGGCAACTATTATCTCAGCCACTCTCGAGAGTGGCTGAGATAATAGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003211    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_032435.x-4199s1c1
Sequence:CCGGCCTCCATCAGTAGCCCTTTATCTCGAGATAAAGGGCTACTGATGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_032435.x-1423s1c1
Sequence:CCGGCGTCCATCGTTTGCCTTAATTCTCGAGAATTAAGGCAAACGATGGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_032435.x-1413s1c1
Sequence:CCGGCCCTCATATTCGTCCATCGTTCTCGAGAACGATGGACGAATATGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_032435.x-2263s1c1
Sequence:CCGGGCCTACATTGATCTACCTCTTCTCGAGAAGAGGTAGATCAATGTAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196251    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032435.1-1330s1c1
Sequence:CCGGGCAGTCAATAAACTCACTTTGCTCGAGCAAAGTGAGTTTATTGACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032435.1-2377s1c1
Sequence:CCGGCCTACGAATAGTCTGAGTAGACTCGAGTCTACTCAGACTATTCGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032435.1-1090s1c1
Sequence:CCGGCATGATGACATCTGCAATAAACTCGAGTTTATTGCAGATGTCATCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032435.2-1413s21c1
Sequence:CCGGCCCTCATATTCGTCCATCGTTCTCGAGAACGATGGACGAATATGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032435.2-2971s21c1
Sequence:CCGGGCAACTATTATCTCAGCCACTCTCGAGAGTGGCTGAGATAATAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032435.2-4198s21c1
Sequence:CCGGCCTCCATCAGTAGCCCTTTATCTCGAGATAAAGGGCTACTGATGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032435.2-2263s21c1
Sequence:CCGGGCCTACATTGATCTACCTCTTCTCGAGAAGAGGTAGATCAATGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032435
VALIDATED
KIAA1804 MISSION shRNA shRNA Plasmid DNA
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_032435.x-2971s1c1
Sequence:CCGGGCAACTATTATCTCAGCCACTCTCGAGAGTGGCTGAGATAATAGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003211    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_032435.x-4199s1c1
Sequence:CCGGCCTCCATCAGTAGCCCTTTATCTCGAGATAAAGGGCTACTGATGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_032435.x-1423s1c1
Sequence:CCGGCGTCCATCGTTTGCCTTAATTCTCGAGAATTAAGGCAAACGATGGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_032435.x-1413s1c1
Sequence:CCGGCCCTCATATTCGTCCATCGTTCTCGAGAACGATGGACGAATATGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_032435.x-2263s1c1
Sequence:CCGGGCCTACATTGATCTACCTCTTCTCGAGAAGAGGTAGATCAATGTAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196251    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032435.1-1330s1c1
Sequence:CCGGGCAGTCAATAAACTCACTTTGCTCGAGCAAAGTGAGTTTATTGACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032435.1-2377s1c1
Sequence:CCGGCCTACGAATAGTCTGAGTAGACTCGAGTCTACTCAGACTATTCGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032435.1-1090s1c1
Sequence:CCGGCATGATGACATCTGCAATAAACTCGAGTTTATTGCAGATGTCATCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032435.2-1413s21c1
Sequence:CCGGCCCTCATATTCGTCCATCGTTCTCGAGAACGATGGACGAATATGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032435.2-2971s21c1
Sequence:CCGGGCAACTATTATCTCAGCCACTCTCGAGAGTGGCTGAGATAATAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032435.2-4198s21c1
Sequence:CCGGCCTCCATCAGTAGCCCTTTATCTCGAGATAAAGGGCTACTGATGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032435.2-2263s21c1
Sequence:CCGGGCCTACATTGATCTACCTCTTCTCGAGAAGAGGTAGATCAATGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032435
VALIDATED
KIAA1804 MISSION shRNA Lentiviral Transduction Particles
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_032435.x-2971s1c1
Sequence:CCGGGCAACTATTATCTCAGCCACTCTCGAGAGTGGCTGAGATAATAGTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003211    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_032435.x-4199s1c1
Sequence:CCGGCCTCCATCAGTAGCCCTTTATCTCGAGATAAAGGGCTACTGATGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_032435.x-1423s1c1
Sequence:CCGGCGTCCATCGTTTGCCTTAATTCTCGAGAATTAAGGCAAACGATGGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_032435.x-1413s1c1
Sequence:CCGGCCCTCATATTCGTCCATCGTTCTCGAGAACGATGGACGAATATGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_032435.x-2263s1c1
Sequence:CCGGGCCTACATTGATCTACCTCTTCTCGAGAAGAGGTAGATCAATGTAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196251    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032435.1-1330s1c1
Sequence:CCGGGCAGTCAATAAACTCACTTTGCTCGAGCAAAGTGAGTTTATTGACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032435.1-2377s1c1
Sequence:CCGGCCTACGAATAGTCTGAGTAGACTCGAGTCTACTCAGACTATTCGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032435.1-1090s1c1
Sequence:CCGGCATGATGACATCTGCAATAAACTCGAGTTTATTGCAGATGTCATCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032435.2-1413s21c1
Sequence:CCGGCCCTCATATTCGTCCATCGTTCTCGAGAACGATGGACGAATATGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032435.2-2971s21c1
Sequence:CCGGGCAACTATTATCTCAGCCACTCTCGAGAGTGGCTGAGATAATAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032435.2-4198s21c1
Sequence:CCGGCCTCCATCAGTAGCCCTTTATCTCGAGATAAAGGGCTACTGATGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032435.2-2263s21c1
Sequence:CCGGGCCTACATTGATCTACCTCTTCTCGAGAAGAGGTAGATCAATGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)