EMAIL THIS PAGE TO A FRIEND

KIAA1841

KIAA1841

133 Gene Product Result for
UniProtKB ID: Q6NSI8, Q49AF0, Q6ZND0, Q96JI6
Gene ID:
chicken(421196) KIAA1841
cow(538151) KIAA1841 ortholog
domestic cat(101100296) KIAA1841 ortholog
dog(481384) KIAA1841 ortholog
domestic guinea pig(100733112) KIAA1841 ortholog
naked mole-rat(101697835) KIAA1841 ortholog
sheep(101110929) KIAA1841 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032506 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032506 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032506 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU078421 MISSION® esiRNA esiRNA human KIAA1841 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032506 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032506 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171390 predicted 688
2 SASI_Hs01_00171392 predicted 816
3 SASI_Hs01_00171393 predicted 1416
4 SASI_Hs02_00359992 predicted 1717
5 SASI_Hs01_00171394 predicted 1004
6 SASI_Hs01_00171395 predicted 1833
7 SASI_Hs01_00171396 predicted 1808
8 SASI_Hs01_00171397 predicted 1729
9 SASI_Hs01_00171398 predicted 1756
10 SASI_Hs01_00171399 predicted 640
11 SASI_Hs01_00171391 predicted 1178
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032506
KIAA1841 MISSION shRNA Bacterial Glycerol Stock
KIAA1841
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032506.2-1475s21c1
Sequence:CCGGATGGGATGTTCATGAGTATTTCTCGAGAAATACTCATGAACATCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032506.1-1656s1c1
Sequence:CCGGGCAAGTTCATTGAATACTGTTCTCGAGAACAGTATTCAATGAACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032506.1-1161s1c1
Sequence:CCGGCCATGCAACATGAACTGTATTCTCGAGAATACAGTTCATGTTGCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032506.2-1781s21c1
Sequence:CCGGTCAAGGTGAAGGCGGAGATTTCTCGAGAAATCTCCGCCTTCACCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032506.2-569s21c1
Sequence:CCGGGCCTGTTGACAACCAGTATAACTCGAGTTATACTGGTTGTCAACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032506.2-440s21c1
Sequence:CCGGCATGATCCTTTATCCATTAATCTCGAGATTAATGGATAAAGGATCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167246    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032506.1-2895s1c1
Sequence:CCGGCCATGCATGTTGTTATACTTTCTCGAGAAAGTATAACAACATGCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263317    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032506.2-2581s21c1
Sequence:CCGGGACAGATTTACATCGATATATCTCGAGATATATCGATGTAAATCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032506
KIAA1841 MISSION shRNA shRNA Plasmid DNA
KIAA1841
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032506.2-1475s21c1
Sequence:CCGGATGGGATGTTCATGAGTATTTCTCGAGAAATACTCATGAACATCCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032506.1-1656s1c1
Sequence:CCGGGCAAGTTCATTGAATACTGTTCTCGAGAACAGTATTCAATGAACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032506.1-1161s1c1
Sequence:CCGGCCATGCAACATGAACTGTATTCTCGAGAATACAGTTCATGTTGCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032506.2-1781s21c1
Sequence:CCGGTCAAGGTGAAGGCGGAGATTTCTCGAGAAATCTCCGCCTTCACCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032506.2-569s21c1
Sequence:CCGGGCCTGTTGACAACCAGTATAACTCGAGTTATACTGGTTGTCAACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032506.2-440s21c1
Sequence:CCGGCATGATCCTTTATCCATTAATCTCGAGATTAATGGATAAAGGATCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167246    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032506.1-2895s1c1
Sequence:CCGGCCATGCATGTTGTTATACTTTCTCGAGAAAGTATAACAACATGCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263317    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032506.2-2581s21c1
Sequence:CCGGGACAGATTTACATCGATATATCTCGAGATATATCGATGTAAATCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032506
KIAA1841 MISSION shRNA Lentiviral Transduction Particles
KIAA1841
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032506.2-1475s21c1
Sequence:CCGGATGGGATGTTCATGAGTATTTCTCGAGAAATACTCATGAACATCCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032506.1-1656s1c1
Sequence:CCGGGCAAGTTCATTGAATACTGTTCTCGAGAACAGTATTCAATGAACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032506.1-1161s1c1
Sequence:CCGGCCATGCAACATGAACTGTATTCTCGAGAATACAGTTCATGTTGCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032506.2-1781s21c1
Sequence:CCGGTCAAGGTGAAGGCGGAGATTTCTCGAGAAATCTCCGCCTTCACCTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032506.2-569s21c1
Sequence:CCGGGCCTGTTGACAACCAGTATAACTCGAGTTATACTGGTTGTCAACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032506.2-440s21c1
Sequence:CCGGCATGATCCTTTATCCATTAATCTCGAGATTAATGGATAAAGGATCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167246    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032506.1-2895s1c1
Sequence:CCGGCCATGCATGTTGTTATACTTTCTCGAGAAAGTATAACAACATGCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263317    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032506.2-2581s21c1
Sequence:CCGGGACAGATTTACATCGATATATCTCGAGATATATCGATGTAAATCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)