EMAIL THIS PAGE TO A FRIEND

KIAA1875

KIAA1875

45 Gene Product Result for
UniProtKB ID: A6NE52, Q96JF2
Gene ID:
cow(509114) KIAA1875 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032529 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032529 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032529 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032529 Rosetta Predictions human pricing
XM_001714583 Rosetta Predictions human pricing
XM_001714978 Rosetta Predictions human pricing
XM_001717214 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032529 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028858 predicted 2316
2 SASI_Hs01_00028859 predicted 2022
3 SASI_Hs01_00028860 predicted 903
4 SASI_Hs01_00028861 predicted 1880
5 SASI_Hs01_00028862 predicted 2309
6 SASI_Hs01_00028863 predicted 2310
7 SASI_Hs01_00028864 predicted 1841
8 SASI_Hs01_00028865 predicted 997
9 SASI_Hs01_00028866 predicted 2303
10 SASI_Hs01_00028867 predicted 1298
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714583 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00398092 predicted 2385
2 SASI_Hs02_00398093 predicted 2093
3 SASI_Hs02_00398094 predicted 979
4 SASI_Hs02_00398095 predicted 1955
5 SASI_Hs02_00398096 predicted 2385
6 SASI_Hs02_00398097 predicted 2383
7 SASI_Hs02_00398098 predicted 1906
8 SASI_Hs02_00398099 predicted 1060
9 SASI_Hs02_00398100 predicted 2382
10 SASI_Hs02_00398101 predicted 1363
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714978 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00400659 predicted 2383
2 SASI_Hs02_00400660 predicted 2091
3 SASI_Hs02_00400661 predicted 1360
4 SASI_Hs02_00400662 predicted 975
5 SASI_Hs02_00400663 predicted 1959
6 SASI_Hs02_00400664 predicted 2383
7 SASI_Hs02_00400665 predicted 2383
8 SASI_Hs02_00400666 predicted 1909
9 SASI_Hs02_00400667 predicted 1069
10 SASI_Hs02_00400668 predicted 2376
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717214 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00415772 predicted 2301
2 SASI_Hs02_00415773 predicted 2004
3 SASI_Hs02_00415774 predicted 893
4 SASI_Hs02_00415775 predicted 1876
5 SASI_Hs02_00415776 predicted 2299
6 SASI_Hs02_00415777 predicted 2302
7 SASI_Hs02_00415778 predicted 1829
8 SASI_Hs02_00415779 predicted 983
9 SASI_Hs02_00415780 predicted 2292
10 SASI_Hs02_00415781 predicted 1277
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032529
KIAA1875 MISSION shRNA Bacterial Glycerol Stock
KIAA1875
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032529.1-1845s1c1
Sequence:CCGGCCTGGAACAGCATTGTGTCTTCTCGAGAAGACACAATGCTGTTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163740    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032529.1-4104s1c1
Sequence:CCGGGCTCATGTCCTACTTCCTCTACTCGAGTAGAGGAAGTAGGACATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032529.1-133s1c1
Sequence:CCGGGAATGAGTTGACTTTCACGGACTCGAGTCCGTGAAAGTCAACTCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160956    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032529.1-3753s1c1
Sequence:CCGGGCCCAAGTTTCTGCATTTCTTCTCGAGAAGAAATGCAGAAACTTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032529.1-1786s1c1
Sequence:CCGGGAAGACTGTCTTCCAAACGGACTCGAGTCCGTTTGGAAGACAGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032529
KIAA1875 MISSION shRNA shRNA Plasmid DNA
KIAA1875
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032529.1-1845s1c1
Sequence:CCGGCCTGGAACAGCATTGTGTCTTCTCGAGAAGACACAATGCTGTTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163740    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032529.1-4104s1c1
Sequence:CCGGGCTCATGTCCTACTTCCTCTACTCGAGTAGAGGAAGTAGGACATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032529.1-133s1c1
Sequence:CCGGGAATGAGTTGACTTTCACGGACTCGAGTCCGTGAAAGTCAACTCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160956    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032529.1-3753s1c1
Sequence:CCGGGCCCAAGTTTCTGCATTTCTTCTCGAGAAGAAATGCAGAAACTTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032529.1-1786s1c1
Sequence:CCGGGAAGACTGTCTTCCAAACGGACTCGAGTCCGTTTGGAAGACAGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032529
KIAA1875 MISSION shRNA Lentiviral Transduction Particles
KIAA1875
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032529.1-1845s1c1
Sequence:CCGGCCTGGAACAGCATTGTGTCTTCTCGAGAAGACACAATGCTGTTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163740    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032529.1-4104s1c1
Sequence:CCGGGCTCATGTCCTACTTCCTCTACTCGAGTAGAGGAAGTAGGACATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032529.1-133s1c1
Sequence:CCGGGAATGAGTTGACTTTCACGGACTCGAGTCCGTGAAAGTCAACTCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160956    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032529.1-3753s1c1
Sequence:CCGGGCCCAAGTTTCTGCATTTCTTCTCGAGAAGAAATGCAGAAACTTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032529.1-1786s1c1
Sequence:CCGGGAAGACTGTCTTCCAAACGGACTCGAGTCCGTTTGGAAGACAGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)