EMAIL THIS PAGE TO A FRIEND

KIAA1919

KIAA1919

21 Gene Product Result for
Synonyms: MFSD4B NaGLT1
Gene ID:
chicken(428623) KIAA1919
cow(539486) KIAA1919 ortholog
domestic cat(101087406) KIAA1919 ortholog
dog(481962) KIAA1919 ortholog
sheep(101106853) KIAA1919 ortholog
domestic guinea pig(100717913) KIAA1919 ortholog
naked mole-rat(101723631) KIAA1919 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153369 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153369 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153369 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU019261 MISSION® esiRNA esiRNA targeting human KIAA1919 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153369 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153369 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367246 predicted 695
2 SASI_Hs01_00124277 predicted 1535
3 SASI_Hs02_00367247 predicted 2015
4 SASI_Hs01_00124278 predicted 1858
5 SASI_Hs01_00124280 predicted 500
6 SASI_Hs02_00367248 predicted 1417
7 SASI_Hs01_00124281 predicted 1720
8 SASI_Hs01_00124282 predicted 1889
9 SASI_Hs01_00124283 predicted 665
10 SASI_Hs02_00367249 predicted 686
11 SASI_Hs01_00124279 predicted 656
12 SASI_Hs01_00124284 predicted 1703
13 SASI_Hs01_00124285 predicted 1792
14 SASI_Hs01_00124286 predicted 593
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153369
VALIDATED
KIAA1919 MISSION shRNA Bacterial Glycerol Stock
KIAA1919
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263282    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153369.2-2163s21c1
Sequence:CCGGTGGTCTCATACACGTACAATACTCGAGTATTGTACGTGTATGAGACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166922    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153369.1-1902s1c1
Sequence:CCGGCTCACTGACATCTTTGAATAACTCGAGTTATTCAAAGATGTCAGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153369.2-1854s21c1
Sequence:CCGGCCCACAGCTGAAGTCTATAATCTCGAGATTATAGACTTCAGCTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153369.2-1600s21c1
Sequence:CCGGCATCAATAGCTACTGGTATTTCTCGAGAAATACCAGTAGCTATTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_153369.2-539s21c1
Sequence:CCGGGGGTCGTGCCTTGGGATATTTCTCGAGAAATATCCCAAGGCACGACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153369.1-809s1c1
Sequence:CCGGCCTGCACTCAACCAATCATCTCTCGAGAGATGATTGGTTGAGTGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153369.1-697s1c1
Sequence:CCGGGCAGGCCTTACACTTCTCTTTCTCGAGAAAGAGAAGTGTAAGGCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153369.2-1146s21c1
Sequence:CCGGGTTGGAGCTGAGGTAACATATCTCGAGATATGTTACCTCAGCTCCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153369
VALIDATED
KIAA1919 MISSION shRNA shRNA Plasmid DNA
KIAA1919
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263282    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153369.2-2163s21c1
Sequence:CCGGTGGTCTCATACACGTACAATACTCGAGTATTGTACGTGTATGAGACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166922    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153369.1-1902s1c1
Sequence:CCGGCTCACTGACATCTTTGAATAACTCGAGTTATTCAAAGATGTCAGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153369.2-1854s21c1
Sequence:CCGGCCCACAGCTGAAGTCTATAATCTCGAGATTATAGACTTCAGCTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153369.2-1600s21c1
Sequence:CCGGCATCAATAGCTACTGGTATTTCTCGAGAAATACCAGTAGCTATTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_153369.2-539s21c1
Sequence:CCGGGGGTCGTGCCTTGGGATATTTCTCGAGAAATATCCCAAGGCACGACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153369.1-809s1c1
Sequence:CCGGCCTGCACTCAACCAATCATCTCTCGAGAGATGATTGGTTGAGTGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153369.1-697s1c1
Sequence:CCGGGCAGGCCTTACACTTCTCTTTCTCGAGAAAGAGAAGTGTAAGGCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153369.2-1146s21c1
Sequence:CCGGGTTGGAGCTGAGGTAACATATCTCGAGATATGTTACCTCAGCTCCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153369
VALIDATED
KIAA1919 MISSION shRNA Lentiviral Transduction Particles
KIAA1919
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263282    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153369.2-2163s21c1
Sequence:CCGGTGGTCTCATACACGTACAATACTCGAGTATTGTACGTGTATGAGACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166922    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153369.1-1902s1c1
Sequence:CCGGCTCACTGACATCTTTGAATAACTCGAGTTATTCAAAGATGTCAGTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153369.2-1854s21c1
Sequence:CCGGCCCACAGCTGAAGTCTATAATCTCGAGATTATAGACTTCAGCTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153369.2-1600s21c1
Sequence:CCGGCATCAATAGCTACTGGTATTTCTCGAGAAATACCAGTAGCTATTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_153369.2-539s21c1
Sequence:CCGGGGGTCGTGCCTTGGGATATTTCTCGAGAAATATCCCAAGGCACGACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153369.1-809s1c1
Sequence:CCGGCCTGCACTCAACCAATCATCTCTCGAGAGATGATTGGTTGAGTGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153369.1-697s1c1
Sequence:CCGGGCAGGCCTTACACTTCTCTTTCTCGAGAAAGAGAAGTGTAAGGCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153369.2-1146s21c1
Sequence:CCGGGTTGGAGCTGAGGTAACATATCTCGAGATATGTTACCTCAGCTCCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)