EMAIL THIS PAGE TO A FRIEND

KIAA1958

KIAA1958

19 Gene Product Result for
UniProtKB ID: Q8N8K9, Q2M336, Q5T252, Q8TF43, Q96N02
Gene ID:
domestic guinea pig(100731434) KIAA1958 ortholog
naked mole-rat(101712606) KIAA1958 ortholog
sheep(101110732) KIAA1958 ortholog
chicken(431637) KIAA1958
dog(481669) KIAA1958 ortholog
domestic cat(101095052) KIAA1958 ortholog
cow(509630) KIAA1958 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV52567 Anti-KIAA1958 antibody produced in rabbit affinity isolated antibody mouse, rat, canine, guinea pig, horse, human, rabbit, bovine
western blot pricing
HPA020625 Anti-KIAA1958 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133465 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133465 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133465 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU086901 MISSION® esiRNA esiRNA human KIAA1958 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133465 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133465 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200343 predicted 450
2 SASI_Hs01_00200344 predicted 1948
3 SASI_Hs01_00200346 predicted 674
4 SASI_Hs01_00200347 predicted 1513
5 SASI_Hs01_00200348 predicted 1332
6 SASI_Hs01_00200349 predicted 340
7 SASI_Hs02_00363164 predicted 1175
8 SASI_Hs01_00200350 predicted 1637
9 SASI_Hs01_00200351 predicted 2045
10 SASI_Hs01_00200352 predicted 1301
11 SASI_Hs01_00200345 predicted 1416
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133465
VALIDATED
KIAA1958 MISSION shRNA Bacterial Glycerol Stock
KIAA1958
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133465.2-337s21c1
Sequence:CCGGTGCTTATCACTGGCCACTAACCTCGAGGTTAGTGGCCAGTGATAAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133465.2-1455s21c1
Sequence:CCCGCCTTGAATGTGTGGCGTTATTCTCGAGAATAACGCCACACATTCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_133465.1-1404s1c1
Sequence:CCGGGATCTGTGTACCAGTGCAGTACTCGAGTACTGCACTGGTACACAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133465.1-1903s1c1
Sequence:CCGGCGGATCTGATGTATGGTGACACTCGAGTGTCACCATACATCAGATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133465.1-269s1c1
Sequence:CCGGCCTGAAACACTTGCTTTCTGACTCGAGTCAGAAAGCAAGTGTTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133465.1-2069s1c1
Sequence:CCGGCCTCCTCTACAAGTACATGTACTCGAGTACATGTACTTGTAGAGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128495    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_133465.1-2503s1c1
Sequence:CCGGGATGAGTCTAAATCATTCGGACTCGAGTCCGAATGATTTAGACTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133465.1-675s1c1
Sequence:CCGGCCTCAAAGCATTGCTCGCAAACTCGAGTTTGCGAGCAATGCTTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133465
VALIDATED
KIAA1958 MISSION shRNA shRNA Plasmid DNA
KIAA1958
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133465.2-337s21c1
Sequence:CCGGTGCTTATCACTGGCCACTAACCTCGAGGTTAGTGGCCAGTGATAAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133465.2-1455s21c1
Sequence:CCCGCCTTGAATGTGTGGCGTTATTCTCGAGAATAACGCCACACATTCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_133465.1-1404s1c1
Sequence:CCGGGATCTGTGTACCAGTGCAGTACTCGAGTACTGCACTGGTACACAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133465.1-1903s1c1
Sequence:CCGGCGGATCTGATGTATGGTGACACTCGAGTGTCACCATACATCAGATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133465.1-269s1c1
Sequence:CCGGCCTGAAACACTTGCTTTCTGACTCGAGTCAGAAAGCAAGTGTTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133465.1-2069s1c1
Sequence:CCGGCCTCCTCTACAAGTACATGTACTCGAGTACATGTACTTGTAGAGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128495    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_133465.1-2503s1c1
Sequence:CCGGGATGAGTCTAAATCATTCGGACTCGAGTCCGAATGATTTAGACTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133465.1-675s1c1
Sequence:CCGGCCTCAAAGCATTGCTCGCAAACTCGAGTTTGCGAGCAATGCTTTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133465
VALIDATED
KIAA1958 MISSION shRNA Lentiviral Transduction Particles
KIAA1958
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133465.2-337s21c1
Sequence:CCGGTGCTTATCACTGGCCACTAACCTCGAGGTTAGTGGCCAGTGATAAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133465.2-1455s21c1
Sequence:CCCGCCTTGAATGTGTGGCGTTATTCTCGAGAATAACGCCACACATTCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_133465.1-1404s1c1
Sequence:CCGGGATCTGTGTACCAGTGCAGTACTCGAGTACTGCACTGGTACACAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133465.1-1903s1c1
Sequence:CCGGCGGATCTGATGTATGGTGACACTCGAGTGTCACCATACATCAGATCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133465.1-269s1c1
Sequence:CCGGCCTGAAACACTTGCTTTCTGACTCGAGTCAGAAAGCAAGTGTTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133465.1-2069s1c1
Sequence:CCGGCCTCCTCTACAAGTACATGTACTCGAGTACATGTACTTGTAGAGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128495    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_133465.1-2503s1c1
Sequence:CCGGGATGAGTCTAAATCATTCGGACTCGAGTCCGAATGATTTAGACTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133465.1-675s1c1
Sequence:CCGGCCTCAAAGCATTGCTCGCAAACTCGAGTTTGCGAGCAATGCTTTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)